Back to Multiple platform build/check report for BioC 3.18: simplified long |
|
This page was generated on 2023-11-02 11:40:34 -0400 (Thu, 02 Nov 2023).
Hostname | OS | Arch (*) | R version | Installed pkgs |
---|---|---|---|---|
nebbiolo2 | Linux (Ubuntu 22.04.2 LTS) | x86_64 | 4.3.1 (2023-06-16) -- "Beagle Scouts" | 4729 |
palomino4 | Windows Server 2022 Datacenter | x64 | 4.3.1 (2023-06-16 ucrt) -- "Beagle Scouts" | 4463 |
lconway | macOS 12.6.5 Monterey | x86_64 | 4.3.1 Patched (2023-06-17 r84564) -- "Beagle Scouts" | 4478 |
kunpeng2 | Linux (openEuler 22.03 LTS-SP1) | aarch64 | 4.3.1 (2023-06-16) -- "Beagle Scouts" | 4464 |
Click on any hostname to see more info about the system (e.g. compilers) (*) as reported by 'uname -p', except on Windows and Mac OS X |
Package 456/2266 | Hostname | OS / Arch | INSTALL | BUILD | CHECK | BUILD BIN | ||||||||
crisprDesign 1.4.0 (landing page) Jean-Philippe Fortin
| nebbiolo2 | Linux (Ubuntu 22.04.2 LTS) / x86_64 | OK | OK | OK | ![]() | ||||||||
palomino4 | Windows Server 2022 Datacenter / x64 | OK | OK | OK | OK | ![]() | ||||||||
lconway | macOS 12.6.5 Monterey / x86_64 | OK | OK | OK | OK | ![]() | ||||||||
kjohnson1 | macOS 13.6.1 Ventura / arm64 | see weekly results here | ||||||||||||
kunpeng2 | Linux (openEuler 22.03 LTS-SP1) / aarch64 | OK | OK | ERROR | ||||||||||
To the developers/maintainers of the crisprDesign package: - Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/crisprDesign.git to reflect on this report. See Troubleshooting Build Report for more information. - Use the following Renviron settings to reproduce errors and warnings. - If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information. - See Martin Grigorov's blog post for how to debug Linux ARM64 related issues on a x86_64 host. |
Package: crisprDesign |
Version: 1.4.0 |
Command: /home/biocbuild/R/R-4.3.1/bin/R CMD check --install=check:crisprDesign.install-out.txt --library=/home/biocbuild/R/R-4.3.1/site-library --no-vignettes --timings crisprDesign_1.4.0.tar.gz |
StartedAt: 2023-11-02 09:38:53 -0000 (Thu, 02 Nov 2023) |
EndedAt: 2023-11-02 09:47:20 -0000 (Thu, 02 Nov 2023) |
EllapsedTime: 507.1 seconds |
RetCode: 1 |
Status: ERROR |
CheckDir: crisprDesign.Rcheck |
Warnings: NA |
############################################################################## ############################################################################## ### ### Running command: ### ### /home/biocbuild/R/R-4.3.1/bin/R CMD check --install=check:crisprDesign.install-out.txt --library=/home/biocbuild/R/R-4.3.1/site-library --no-vignettes --timings crisprDesign_1.4.0.tar.gz ### ############################################################################## ############################################################################## * using log directory ‘/home/biocbuild/bbs-3.18-bioc/meat/crisprDesign.Rcheck’ * using R version 4.3.1 (2023-06-16) * using platform: aarch64-unknown-linux-gnu (64-bit) * R was compiled by gcc (GCC) 10.3.1 GNU Fortran (GCC) 10.3.1 * running under: openEuler 22.03 (LTS-SP1) * using session charset: UTF-8 * using option ‘--no-vignettes’ * checking for file ‘crisprDesign/DESCRIPTION’ ... OK * this is package ‘crisprDesign’ version ‘1.4.0’ * package encoding: UTF-8 * checking package namespace information ... OK * checking package dependencies ... OK * checking if this is a source package ... OK * checking if there is a namespace ... OK * checking for hidden files and directories ... NOTE Found the following hidden files and directories: .BBSoptions These were most likely included in error. See section ‘Package structure’ in the ‘Writing R Extensions’ manual. * checking for portable file names ... OK * checking for sufficient/correct file permissions ... OK * checking whether package ‘crisprDesign’ can be installed ... OK * checking installed package size ... OK * checking package directory ... OK * checking ‘build’ directory ... OK * checking DESCRIPTION meta-information ... OK * checking top-level files ... OK * checking for left-over files ... OK * checking index information ... OK * checking package subdirectories ... OK * checking R files for non-ASCII characters ... OK * checking R files for syntax errors ... OK * checking whether the package can be loaded ... OK * checking whether the package can be loaded with stated dependencies ... OK * checking whether the package can be unloaded cleanly ... OK * checking whether the namespace can be loaded with stated dependencies ... OK * checking whether the namespace can be unloaded cleanly ... OK * checking loading without being on the library search path ... OK * checking dependencies in R code ... OK * checking S3 generic/method consistency ... OK * checking replacement functions ... OK * checking foreign function calls ... OK * checking R code for possible problems ... OK * checking Rd files ... OK * checking Rd metadata ... OK * checking Rd cross-references ... OK * checking for missing documentation entries ... OK * checking for code/documentation mismatches ... OK * checking Rd \usage sections ... OK * checking Rd contents ... OK * checking for unstated dependencies in examples ... OK * checking contents of ‘data’ directory ... OK * checking data for non-ASCII characters ... OK * checking LazyData ... OK * checking data for ASCII and uncompressed saves ... OK * checking files in ‘vignettes’ ... OK * checking examples ... ERROR Running examples in ‘crisprDesign-Ex.R’ failed The error most likely occurred in: > base::assign(".ptime", proc.time(), pos = "CheckExEnv") > ### Name: addCompositeScores > ### Title: Add on-target composite score to a GuideSet object. > ### Aliases: addCompositeScores addCompositeScores,GuideSet-method > ### addCompositeScores,PairedGuideSet-method > ### addCompositeScores,NULL-method > > ### ** Examples > > gs <- findSpacers("CCAACATAGTGAAACCACGTCTCTATAAAGAATAAAAAATTAGCCGGGTTA") > gs <- addOnTargetScores(gs, methods=c("ruleset1", "crisprater")) [addOnTargetScores] Adding ruleset1 scores. Warning in valid.GenomicRanges.seqinfo(x, suggest.trim = TRUE) : GRanges object contains 2 out-of-bound ranges located on sequence region_1. Note that ranges located on a sequence whose length is unknown (NA) or on a circular sequence are not considered out-of-bound (use seqlengths() and isCircular() to get the lengths and circularity flags of the underlying sequences). You can use trim() to trim these ranges. See ?`trim,GenomicRanges-method` for more information. Warning in valid.GenomicRanges.seqinfo(x, suggest.trim = TRUE) : GRanges object contains 2 out-of-bound ranges located on sequence region_1. Note that ranges located on a sequence whose length is unknown (NA) or on a circular sequence are not considered out-of-bound (use seqlengths() and isCircular() to get the lengths and circularity flags of the underlying sequences). You can use trim() to trim these ranges. See ?`trim,GenomicRanges-method` for more information. Warning in valid.GenomicRanges.seqinfo(x, suggest.trim = TRUE) : GRanges object contains 2 out-of-bound ranges located on sequence region_1. Note that ranges located on a sequence whose length is unknown (NA) or on a circular sequence are not considered out-of-bound (use seqlengths() and isCircular() to get the lengths and circularity flags of the underlying sequences). You can use trim() to trim these ranges. See ?`trim,GenomicRanges-method` for more information. Warning in valid.GenomicRanges.seqinfo(x, suggest.trim = TRUE) : GRanges object contains 1 out-of-bound range located on sequence region_1. Note that ranges located on a sequence whose length is unknown (NA) or on a circular sequence are not considered out-of-bound (use seqlengths() and isCircular() to get the lengths and circularity flags of the underlying sequences). You can use trim() to trim these ranges. See ?`trim,GenomicRanges-method` for more information. [addOnTargetScores] Adding crisprater scores. Warning in valid.GenomicRanges.seqinfo(x, suggest.trim = TRUE) : GRanges object contains 2 out-of-bound ranges located on sequence region_1. Note that ranges located on a sequence whose length is unknown (NA) or on a circular sequence are not considered out-of-bound (use seqlengths() and isCircular() to get the lengths and circularity flags of the underlying sequences). You can use trim() to trim these ranges. See ?`trim,GenomicRanges-method` for more information. Warning in valid.GenomicRanges.seqinfo(x, suggest.trim = TRUE) : GRanges object contains 2 out-of-bound ranges located on sequence region_1. Note that ranges located on a sequence whose length is unknown (NA) or on a circular sequence are not considered out-of-bound (use seqlengths() and isCircular() to get the lengths and circularity flags of the underlying sequences). You can use trim() to trim these ranges. See ?`trim,GenomicRanges-method` for more information. Warning in valid.GenomicRanges.seqinfo(x, suggest.trim = TRUE) : GRanges object contains 2 out-of-bound ranges located on sequence region_1. Note that ranges located on a sequence whose length is unknown (NA) or on a circular sequence are not considered out-of-bound (use seqlengths() and isCircular() to get the lengths and circularity flags of the underlying sequences). You can use trim() to trim these ranges. See ?`trim,GenomicRanges-method` for more information. * checking for unstated dependencies in ‘tests’ ... OK * checking tests ... Running ‘testthat.R’/home/biocbuild/R/R-4.3.1/bin/BATCH: line 60: 874648 Killed ${R_HOME}/bin/R -f ${in} ${opts} ${R_BATCH_OPTIONS} > ${out} 2>&1 ERROR Running the tests in ‘tests/testthat.R’ failed. Complete output: > library(testthat) > library(crisprDesign) Loading required package: crisprBase > > test_check("crisprDesign") * checking for unstated dependencies in vignettes ... OK * checking package vignettes in ‘inst/doc’ ... OK * checking running R code from vignettes ... SKIPPED * checking re-building of vignette outputs ... SKIPPED * checking PDF version of manual ... OK * DONE Status: 2 ERRORs, 1 NOTE See ‘/home/biocbuild/bbs-3.18-bioc/meat/crisprDesign.Rcheck/00check.log’ for details.
crisprDesign.Rcheck/00install.out
############################################################################## ############################################################################## ### ### Running command: ### ### /home/biocbuild/R/R-4.3.1/bin/R CMD INSTALL crisprDesign ### ############################################################################## ############################################################################## * installing to library ‘/home/biocbuild/R/R-4.3.1/site-library’ * installing *source* package ‘crisprDesign’ ... ** using staged installation ** R ** data *** moving datasets to lazyload DB ** inst ** byte-compile and prepare package for lazy loading ** help *** installing help indices ** building package indices ** installing vignettes ** testing if installed package can be loaded from temporary location ** testing if installed package can be loaded from final location ** testing if installed package keeps a record of temporary installation path * DONE (crisprDesign)
crisprDesign.Rcheck/tests/testthat.Rout.fail
R version 4.3.1 (2023-06-16) -- "Beagle Scouts" Copyright (C) 2023 The R Foundation for Statistical Computing Platform: aarch64-unknown-linux-gnu (64-bit) R is free software and comes with ABSOLUTELY NO WARRANTY. You are welcome to redistribute it under certain conditions. Type 'license()' or 'licence()' for distribution details. R is a collaborative project with many contributors. Type 'contributors()' for more information and 'citation()' on how to cite R or R packages in publications. Type 'demo()' for some demos, 'help()' for on-line help, or 'help.start()' for an HTML browser interface to help. Type 'q()' to quit R. > library(testthat) > library(crisprDesign) Loading required package: crisprBase > > test_check("crisprDesign")
crisprDesign.Rcheck/crisprDesign-Ex.timings
name | user | system | elapsed | |
GuideSet-class | 0.204 | 0.008 | 0.223 | |
GuideSet2DataFrames | 1.421 | 0.114 | 1.717 | |
PairedGuideSet-class | 0.548 | 0.012 | 0.563 | |
TxDb2GRangesList | 0.000 | 0.000 | 0.001 | |