| Back to Multiple platform build/check report for BioC 3.20: simplified long |
|
This page was generated on 2024-11-20 12:02 -0500 (Wed, 20 Nov 2024).
| Hostname | OS | Arch (*) | R version | Installed pkgs |
|---|---|---|---|---|
| teran2 | Linux (Ubuntu 24.04.1 LTS) | x86_64 | 4.4.2 (2024-10-31) -- "Pile of Leaves" | 4481 |
| nebbiolo2 | Linux (Ubuntu 24.04.1 LTS) | x86_64 | 4.4.2 (2024-10-31) -- "Pile of Leaves" | 4479 |
| palomino8 | Windows Server 2022 Datacenter | x64 | 4.4.2 (2024-10-31 ucrt) -- "Pile of Leaves" | 4359 |
| lconway | macOS 12.7.1 Monterey | x86_64 | 4.4.1 (2024-06-14) -- "Race for Your Life" | 4539 |
| kunpeng2 | Linux (openEuler 22.03 LTS-SP1) | aarch64 | 4.4.1 (2024-06-14) -- "Race for Your Life" | 4493 |
| Click on any hostname to see more info about the system (e.g. compilers) (*) as reported by 'uname -p', except on Windows and Mac OS X | ||||
| Package 721/2289 | Hostname | OS / Arch | INSTALL | BUILD | CHECK | BUILD BIN | ||||||||
| FLAMES 2.0.1 (landing page) Changqing Wang
| teran2 | Linux (Ubuntu 24.04.1 LTS) / x86_64 | OK | OK | OK | |||||||||
| nebbiolo2 | Linux (Ubuntu 24.04.1 LTS) / x86_64 | OK | OK | OK | ||||||||||
| palomino8 | Windows Server 2022 Datacenter / x64 | ... NOT SUPPORTED ... | ||||||||||||
| lconway | macOS 12.7.1 Monterey / x86_64 | OK | OK | OK | OK | |||||||||
| kunpeng2 | Linux (openEuler 22.03 LTS-SP1) / aarch64 | OK | OK | ERROR | ||||||||||
|
To the developers/maintainers of the FLAMES package: - Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/FLAMES.git to reflect on this report. See Troubleshooting Build Report for more information. - Use the following Renviron settings to reproduce errors and warnings. - If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information. |
| Package: FLAMES |
| Version: 2.0.1 |
| Command: /home/biocbuild/bbs-3.20-bioc/R/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/home/biocbuild/bbs-3.20-bioc/R/site-library --timings FLAMES_2.0.1.tar.gz |
| StartedAt: 2024-11-20 02:58:21 -0500 (Wed, 20 Nov 2024) |
| EndedAt: 2024-11-20 03:12:37 -0500 (Wed, 20 Nov 2024) |
| EllapsedTime: 855.4 seconds |
| RetCode: 0 |
| Status: OK |
| CheckDir: FLAMES.Rcheck |
| Warnings: 0 |
##############################################################################
##############################################################################
###
### Running command:
###
### /home/biocbuild/bbs-3.20-bioc/R/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/home/biocbuild/bbs-3.20-bioc/R/site-library --timings FLAMES_2.0.1.tar.gz
###
##############################################################################
##############################################################################
* using log directory ‘/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/meat/FLAMES.Rcheck’
* using R version 4.4.2 (2024-10-31)
* using platform: x86_64-pc-linux-gnu
* R was compiled by
gcc (Ubuntu 13.2.0-23ubuntu4) 13.2.0
GNU Fortran (Ubuntu 13.2.0-23ubuntu4) 13.2.0
* running under: Ubuntu 24.04.1 LTS
* using session charset: UTF-8
* checking for file ‘FLAMES/DESCRIPTION’ ... OK
* this is package ‘FLAMES’ version ‘2.0.1’
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... OK
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... OK
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘FLAMES’ can be installed ... NOTE
Found the following notes/warnings:
Non-staged installation was used
See ‘/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/meat/FLAMES.Rcheck/00install.out’ for details.
* used C++ compiler: ‘g++ (Ubuntu 13.2.0-23ubuntu4) 13.2.0’
* checking C++ specification ... OK
Not all R platforms support C++17
* checking installed package size ... NOTE
installed size is 5.3Mb
sub-directories of 1Mb or more:
data 2.7Mb
libs 1.5Mb
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking code files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking loading without being on the library search path ... OK
* checking dependencies in R code ... OK
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... NOTE
create_spe: no visible binding for global variable 'barcode'
filter_coverage: no visible global function definition for
'starts_with'
filter_coverage: no visible binding for global variable 'filter_res'
find_barcode: no visible binding for global variable 'Sample'
find_barcode: no visible binding for global variable 'Outfile'
find_variants_grange: no visible binding for global variable
'which_label'
find_variants_grange: no visible binding for global variable
'nucleotide'
find_variants_grange: no visible binding for global variable 'pos'
find_variants_grange: no visible binding for global variable 'count'
find_variants_grange: no visible binding for global variable
'counts_no_ins'
find_variants_grange: no visible binding for global variable 'ref'
generate_sc_sce: no visible binding for global variable 'FSM_match'
get_coverage: no visible binding for global variable 'Freq'
homopolymer_pct : <anonymous>: no visible binding for global variable
'Freq'
homopolymer_pct : <anonymous>: no visible binding for global variable
'pct'
plot_coverage: no visible binding for global variable 'tr_length'
plot_coverage: no visible binding for global variable 'read_counts'
plot_coverage: no visible binding for global variable 'total_counts'
plot_coverage: no visible binding for global variable 'cumpct'
plot_coverage: no visible binding for global variable 'length_bin'
plot_coverage: no visible binding for global variable 'min_length'
plot_coverage: no visible binding for global variable 'max_length'
plot_coverage: no visible global function definition for 'head'
plot_coverage: no visible binding for global variable 'transcript'
plot_demultiplex: no visible binding for global variable 'CellBarcode'
plot_demultiplex: no visible binding for global variable 'Sample'
plot_demultiplex: no visible binding for global variable 'UMI'
plot_demultiplex: no visible binding for global variable 'UMI_count'
plot_demultiplex: no visible binding for global variable 'barcode_rank'
plot_demultiplex: no visible binding for global variable
'FlankEditDist'
plot_demultiplex: no visible binding for global variable 'n_reads'
plot_demultiplex: no visible binding for global variable
'BarcodeEditDist'
plot_demultiplex: no visible binding for global variable 'total reads'
plot_demultiplex: no visible binding for global variable 'demultiplexed
reads'
plot_demultiplex: no visible binding for global variable 'single match
reads'
plot_demultiplex: no visible binding for global variable
'undemultiplexted reads'
plot_demultiplex: no visible binding for global variable
'multi-matching reads'
plot_demultiplex: no visible binding for global variable 'Type'
plot_demultiplex: no visible binding for global variable 'Reads'
plot_demultiplex: no visible binding for global variable 'input'
plot_demultiplex: no visible binding for global variable 'output'
plot_demultiplex: no visible binding for global variable
'read1_with_adapter'
plot_demultiplex: no visible binding for global variable 'Count'
plot_flagstat: no visible global function definition for 'everything'
plot_flagstat: no visible binding for global variable 'name'
plot_flagstat: no visible binding for global variable 'value'
plot_isoform_heatmap : group_annotation: no visible global function
definition for 'HeatmapAnnotation'
plot_isoform_reduced_dim: no visible binding for global variable 'x'
plot_isoform_reduced_dim: no visible binding for global variable 'y'
plot_isoform_reduced_dim: no visible binding for global variable 'expr'
plot_spatial_isoform: no visible global function definition for 'head'
plot_spatial_pie: no visible global function definition for 'head'
plot_spatial_pie: no visible binding for global variable 'imageY'
plot_spatial_pie: no visible binding for global variable 'imageX'
relative_mutation_positions: no visible binding for global variable
'region'
relative_mutation_positions_single: no visible binding for global
variable 'type'
sc_DTU_analysis: no visible binding for global variable 'FSM_match'
sc_DTU_analysis: no visible binding for global variable 'gene_id'
sc_DTU_analysis: no visible binding for global variable '.'
sc_DTU_analysis: no visible binding for global variable 'cell_id'
sc_DTU_analysis: no visible binding for global variable 'cnt'
sc_DTU_analysis: no visible binding for global variable 'tr_id'
sc_DTU_analysis: no visible binding for global variable 'label'
sc_DTU_analysis : filter_tr: no visible binding for global variable
'gene_id'
sc_DTU_analysis : filter_tr: no visible binding for global variable '.'
sc_mutations: no visible binding for global variable 'mutation_index'
sc_mutations: no visible binding for global variable 'bam_index'
variant_count_tb: no visible binding for global variable 'barcode'
variant_count_tb: no visible binding for global variable 'allele_count'
variant_count_tb: no visible binding for global variable
'cell_total_reads'
Undefined global functions or variables:
. BarcodeEditDist CellBarcode Count FSM_match FlankEditDist Freq
HeatmapAnnotation Outfile Reads Sample Type UMI UMI_count
allele_count bam_index barcode barcode_rank cell_id cell_total_reads
cnt count counts_no_ins cumpct demultiplexed reads everything expr
filter_res gene_id head imageX imageY input label length_bin
max_length min_length multi-matching reads mutation_index n_reads
name nucleotide output pct pos read1_with_adapter read_counts ref
region single match reads starts_with total reads total_counts tr_id
tr_length transcript type undemultiplexted reads value which_label x
y
Consider adding
importFrom("base", "match", "single")
importFrom("utils", "head")
to your NAMESPACE file.
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking contents of ‘data’ directory ... OK
* checking data for non-ASCII characters ... OK
* checking LazyData ... OK
* checking data for ASCII and uncompressed saves ... OK
* checking line endings in shell scripts ... OK
* checking line endings in C/C++/Fortran sources/headers ... OK
* checking line endings in Makefiles ... OK
* checking compilation flags in Makevars ... OK
* checking for GNU extensions in Makefiles ... NOTE
GNU make is a SystemRequirements.
* checking for portable use of $(BLAS_LIBS) and $(LAPACK_LIBS) ... OK
* checking use of PKG_*FLAGS in Makefiles ... OK
* checking compiled code ... NOTE
Note: information on .o files is not available
File ‘/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/FLAMES/libs/FLAMES.so’:
Found ‘abort’, possibly from ‘abort’ (C)
Found ‘exit’, possibly from ‘exit’ (C)
Found ‘stderr’, possibly from ‘stderr’ (C)
Found ‘stdout’, possibly from ‘stdout’ (C)
Compiled code should not call entry points which might terminate R nor
write to stdout/stderr instead of to the console, nor use Fortran I/O
nor system RNGs nor [v]sprintf. The detected symbols are linked into
the code but might come from libraries and not actually be called.
See ‘Writing portable packages’ in the ‘Writing R Extensions’ manual.
* checking files in ‘vignettes’ ... OK
* checking examples ... OK
Examples with CPU (user + system) or elapsed time > 5s
user system elapsed
bulk_long_pipeline 101.940 20.963 146.938
plot_isoform_reduced_dim 19.626 0.176 22.431
create_se_from_dir 10.563 0.393 11.915
sc_long_multisample_pipeline 5.185 5.038 11.159
create_sce_from_dir 4.902 2.276 12.554
relative_mutation_positions 6.447 0.054 7.822
find_variants 5.089 0.034 5.405
get_GRangesList 4.339 0.132 5.227
plot_coverage 4.370 0.092 5.379
find_isoform 4.157 0.129 5.397
sc_DTU_analysis 1.880 1.960 5.082
filter_coverage 2.907 0.084 5.271
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
Running ‘testthat.R’
OK
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes ... OK
* checking re-building of vignette outputs ... OK
* checking PDF version of manual ... OK
* DONE
Status: 5 NOTEs
See
‘/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/meat/FLAMES.Rcheck/00check.log’
for details.
FLAMES.Rcheck/00install.out
##############################################################################
##############################################################################
###
### Running command:
###
### /home/biocbuild/bbs-3.20-bioc/R/bin/R CMD INSTALL FLAMES
###
##############################################################################
##############################################################################
* installing to library ‘/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library’
* installing *source* package ‘FLAMES’ ...
** using non-staged installation via StagedInstall field
** libs
using C++ compiler: ‘g++ (Ubuntu 13.2.0-23ubuntu4) 13.2.0’
using C++17
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -c RcppExports.cpp -o RcppExports.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -c RcppFunctions.cpp -o RcppFunctions.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -c classes/BamRecord.cpp -o classes/BamRecord.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -c classes/GFFRecord.cpp -o classes/GFFRecord.o
In file included from classes/GFFRecord.cpp:8:
classes/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const std::string&)’:
classes/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
255 | for (int i = 0; i < s.size(); i++) {
| ~~^~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -c classes/GeneAnnotationParser.cpp -o classes/GeneAnnotationParser.o
In file included from classes/GeneAnnotationParser.cpp:15:
classes/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const std::string&)’:
classes/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
255 | for (int i = 0; i < s.size(); i++) {
| ~~^~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -c classes/Isoforms.cpp -o classes/Isoforms.o
In file included from classes/Isoforms.cpp:16:
classes/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const std::string&)’:
classes/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
255 | for (int i = 0; i < s.size(); i++) {
| ~~^~~~~~~~~~
classes/Isoforms.cpp: In member function ‘void Isoforms::update_all_splice()’:
classes/Isoforms.cpp:233:35: warning: comparison of integer expressions of different signedness: ‘std::vector<StartEndPair>::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare]
233 | if (blocks.size() >= (int)this->Min_sup_cnt) {
| ~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp: In member function ‘void Isoforms::filter_TSS_TES(std::ofstream&, DoubleJunctions, float)’:
classes/Isoforms.cpp:368:33: warning: comparison of integer expressions of different signedness: ‘std::unordered_map<int, int>::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare]
368 | if ((left_counts.size() < (int)this->Min_sup_cnt) ||
| ~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp:369:38: warning: comparison of integer expressions of different signedness: ‘std::unordered_map<int, int>::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare]
369 | (right_counts.size() < (int)this->Min_sup_cnt)) {
| ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp: In member function ‘void Isoforms::match_known_annotation(const std::unordered_map<std::__cxx11::basic_string<char>, Junctions>&, const std::unordered_map<std::__cxx11::basic_string<char>, Pos>&, const std::unordered_map<std::__cxx11::basic_string<char>, std::vector<StartEndPair> >&, GeneBlocks, std::unordered_map<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> >)’:
classes/Isoforms.cpp:662:51: warning: comparison of integer expressions of different signedness: ‘int’ and ‘const long unsigned int’ [-Wsign-compare]
662 | for (int j = 0; j < std::min(raw_iso_key.size() - 1, junction.junctions.size()); j++) {
| ~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp:713:43: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<int>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
713 | for (int i = 0; i < new_exons.size(); ++i) {
| ~~^~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp:725:46: warning: comparisons like ‘X<=Y<=Z’ do not have their mathematical meaning [-Wparentheses]
725 | } else if (0 < i < raw_iso_key.size() - 1) { // a site from the middle somewhere
| ~~^~~
classes/Isoforms.cpp: In member function ‘std::string Isoforms::isoform_to_gff3(float)’:
classes/Isoforms.cpp:1140:43: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<int>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
1140 | for (int i = 0; i < exons.size(); i+=2) {
| ~~^~~~~~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -c classes/junctions.cpp -o classes/junctions.o
In file included from classes/junctions.cpp:12:
classes/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const std::string&)’:
classes/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
255 | for (int i = 0; i < s.size(); i++) {
| ~~^~~~~~~~~~
classes/junctions.cpp: In function ‘std::unordered_map<std::__cxx11::basic_string<char>, std::vector<StartEndPair> > get_gene_flat(const std::unordered_map<std::__cxx11::basic_string<char>, std::vector<std::__cxx11::basic_string<char> > >&, const std::unordered_map<std::__cxx11::basic_string<char>, std::vector<StartEndPair> >&)’:
classes/junctions.cpp:166:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<StartEndPair>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
166 | for (int i = 1; i < exons.size(); i++) {
| ~~^~~~~~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -c main-functions/find_isoform.cpp -o main-functions/find_isoform.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -c main-functions/flexiplex.cpp -o main-functions/flexiplex.o
main-functions/flexiplex.cpp: In function ‘unsigned int edit_distance(const std::string&, const std::string&, unsigned int&, int)’:
main-functions/flexiplex.cpp:122:21: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare]
122 | if (min_value <= max_editd)
| ~~~~~~~~~~^~~~~~~~~~~~
main-functions/flexiplex.cpp: In function ‘std::string get_umi(const std::string&, const std::vector<std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > >&, const std::vector<int>&, int, int, bool, int, int)’:
main-functions/flexiplex.cpp:163:22: warning: comparison of integer expressions of different signedness: ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare]
163 | if (seq.length() < umi_start + umi_length) {
| ~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:187:36: warning: comparison of integer expressions of different signedness: ‘std::vector<int>::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare]
187 | if (read_to_subpatterns.size() > umi_index + 1) {
| ~~~~~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~
main-functions/flexiplex.cpp: In function ‘Barcode get_barcode(const std::string&, const std::unordered_set<std::__cxx11::basic_string<char> >&, int, int, const std::vector<std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > >&)’:
main-functions/flexiplex.cpp:295:19: warning: comparison of integer expressions of different signedness: ‘int’ and ‘__gnu_cxx::__alloc_traits<std::allocator<long unsigned int>, long unsigned int>::value_type’ {aka ‘long unsigned int’} [-Wsign-compare]
295 | if (i_pattern >= subpattern_ends[i_subpattern]) {
main-functions/flexiplex.cpp:354:22: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare]
354 | if (editDistance == barcode.editd) {
| ~~~~~~~~~~~~~^~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:356:29: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare]
356 | } else if (editDistance < barcode.editd &&
| ~~~~~~~~~~~~~^~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:357:29: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare]
357 | editDistance <= barcode_max_editd) { // if best so far, update
| ~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp: In function ‘std::vector<Barcode> big_barcode_search(const std::string&, const std::unordered_set<std::__cxx11::basic_string<char> >&, int, int, const std::vector<std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > >&)’:
main-functions/flexiplex.cpp:396:29: warning: comparison of integer expressions of different signedness: ‘const int’ and ‘const std::__cxx11::basic_string<char>::size_type’ {aka ‘const long unsigned int’} [-Wsign-compare]
396 | if (barcode.flank_end == std::string::npos) {
| ~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp: In function ‘void print_stats(const std::string&, const std::vector<Barcode>&, std::ostream&)’:
main-functions/flexiplex.cpp:421:38: warning: comparison of integer expressions of different signedness: ‘const int’ and ‘const std::__cxx11::basic_string<char>::size_type’ {aka ‘const long unsigned int’} [-Wsign-compare]
421 | << (barcode.flank_end == std::string::npos ? "True" : "False")
| ~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp: In function ‘void print_read(const std::string&, const std::string&, const std::string&, const std::vector<Barcode>&, std::ofstream&, std::unordered_set<std::__cxx11::basic_string<char> >&, bool, bool, bool)’:
main-functions/flexiplex.cpp:453:21: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
453 | for (int b = 0; b < vec_bc.size(); b++) {
| ~~^~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:468:32: warning: comparison of integer expressions of different signedness: ‘const int’ and ‘const std::__cxx11::basic_string<char>::size_type’ {aka ‘const long unsigned int’} [-Wsign-compare]
468 | if (vec_bc.at(b).flank_end == std::string::npos) {
| ~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:473:23: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
473 | for (int f = 0; f < vec_bc.size(); f++) {
| ~~^~~~~~~~~~~~~~~
main-functions/flexiplex.cpp: In function ‘Rcpp::IntegerVector flexiplex_cpp(Rcpp::StringVector, Rcpp::String, bool, int, int, Rcpp::StringVector, Rcpp::String, Rcpp::String, Rcpp::String, bool, int)’:
main-functions/flexiplex.cpp:730:25: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<std::vector<SearchResult> >::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
730 | for (int t = 0; t < sr_v.size();
| ~~^~~~~~~~~~~~~
main-functions/flexiplex.cpp:735:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<SearchResult>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
735 | for (int r = 0; r < sr_v[t].size(); r++) { // loop over the reads
| ~~^~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:737:29: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
737 | for (int b = 0; b < sr_v[t][r].vec_bc_for.size(); b++)
| ~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:739:29: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
739 | for (int b = 0; b < sr_v[t][r].vec_bc_rev.size(); b++)
| ~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -c main-functions/get_transcript_seq.cpp -o main-functions/get_transcript_seq.o
main-functions/get_transcript_seq.cpp: In function ‘void write_fa(const std::string&, const std::string&, const std::string&, int)’:
main-functions/get_transcript_seq.cpp:87:14: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
87 | while (i < seq.size()) {
| ~~^~~~~~~~~~~~
main-functions/get_transcript_seq.cpp:88:26: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
88 | if (i + wrap_len > seq.size()) {
| ~~~~~~~~~~~~~^~~~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -c main-functions/group_bam2isoform.cpp -o main-functions/group_bam2isoform.o
In file included from main-functions/group_bam2isoform.cpp:18:
main-functions/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const std::string&)’:
main-functions/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
255 | for (int i = 0; i < s.size(); i++) {
| ~~^~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -c main-functions/pileup_readid.cpp -o main-functions/pileup_readid.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -c tests/test-junctions.cpp -o tests/test-junctions.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -c tests/test-parsing.cpp -o tests/test-parsing.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -c utility/cigars.cpp -o utility/cigars.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -c utility/edlib-1.2.7/edlib.cpp -o utility/edlib-1.2.7/edlib.o
gcc -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -c utility/bam.c -o utility/bam.o
g++ -std=gnu++17 -shared -L/home/biocbuild/bbs-3.20-bioc/R/lib -L/usr/local/lib -o FLAMES.so RcppExports.o RcppFunctions.o classes/BamRecord.o classes/GFFRecord.o classes/GeneAnnotationParser.o classes/Isoforms.o classes/junctions.o main-functions/find_isoform.o main-functions/flexiplex.o main-functions/get_transcript_seq.o main-functions/group_bam2isoform.o main-functions/pileup_readid.o tests/test-junctions.o tests/test-parsing.o utility/cigars.o utility/edlib-1.2.7/edlib.o utility/bam.o -pthread -lz /media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/usrlib/libhts.a -lcurl -lbz2 -llzma -lz -L/home/biocbuild/bbs-3.20-bioc/R/lib -lR
if test -e "/usr/bin/strip" & test -e "/bin/uname" & [[ `uname` == "Linux" ]] ; then /usr/bin/strip --strip-debug FLAMES.so; fi
installing to /media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/FLAMES/libs
** R
** data
*** moving datasets to lazyload DB
** inst
** byte-compile and prepare package for lazy loading
** help
*** installing help indices
*** copying figures
** building package indices
** installing vignettes
** testing if installed package can be loaded
* DONE (FLAMES)
FLAMES.Rcheck/tests/testthat.Rout
R version 4.4.2 (2024-10-31) -- "Pile of Leaves"
Copyright (C) 2024 The R Foundation for Statistical Computing
Platform: x86_64-pc-linux-gnu
R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.
R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.
Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.
> # This file is part of the standard setup for testthat.
> # It is recommended that you do not modify it.
> #
> # Where should you do additional test configuration?
> # Learn more about the roles of various files in:
> # * https://r-pkgs.org/tests.html
> # * https://testthat.r-lib.org/reference/test_package.html#special-files
>
> library(testthat)
> library(FLAMES)
>
> test_check("FLAMES")
Writing configuration parameters to: /tmp/RtmpTbLUfe/file3996494032b4a6/config_file_3774025.json
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpTbLUfe/file399649656f41cf/bc_allow.tsv
Number of known barcodes: 143
Processing file: /media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpTbLUfe/file39964947c043ef/bc_allow.tsv
Number of known barcodes: 143
Processing file: /media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpTbLUfe/file39964947c043ef/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpTbLUfe/file39964936697b18/musc_rps24_1.fastq
Searching for barcodes...
Processing file: /tmp/RtmpTbLUfe/file39964936697b18/musc_rps24_2.fastq
Searching for barcodes...
Processing file: /tmp/RtmpTbLUfe/file39964936697b18/musc_rps24_3.fastq
Searching for barcodes...
Processing file: /tmp/RtmpTbLUfe/file39964936697b18/musc_rps24_4.fastq
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpTbLUfe/file39964927e2388f/bc_allow.tsv
Number of known barcodes: 143
Processing file: /media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpTbLUfe/file39964927e2388f/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpTbLUfe/file3996491b658fe5/musc_rps24_1.fastq
Searching for barcodes...
Processing file: /tmp/RtmpTbLUfe/file3996491b658fe5/musc_rps24_2.fastq
Searching for barcodes...
Processing file: /tmp/RtmpTbLUfe/file3996491b658fe5/musc_rps24_3.fastq
Searching for barcodes...
Processing file: /tmp/RtmpTbLUfe/file3996491b658fe5/musc_rps24_4.fastq
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpTbLUfe/file39964927e2388f/bc_allow.tsv
Number of known barcodes: 143
Processing file: /media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpTbLUfe/file399649357f3c64/bc_allow.tsv
Number of known barcodes: 143
Processing file: /media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
[ FAIL 0 | WARN 0 | SKIP 0 | PASS 13 ]
>
> proc.time()
user system elapsed
18.438 1.163 23.895
FLAMES.Rcheck/FLAMES-Ex.timings
| name | user | system | elapsed | |
| annotation_to_fasta | 0.919 | 0.075 | 1.045 | |
| blaze | 0.334 | 0.028 | 2.198 | |
| bulk_long_pipeline | 101.940 | 20.963 | 146.938 | |
| combine_sce | 0.597 | 0.177 | 0.920 | |
| convolution_filter | 0.001 | 0.000 | 0.000 | |
| create_config | 0.004 | 0.001 | 0.005 | |
| create_sce_from_dir | 4.902 | 2.276 | 12.554 | |
| create_se_from_dir | 10.563 | 0.393 | 11.915 | |
| cutadapt | 0 | 0 | 0 | |
| filter_annotation | 0.485 | 0.001 | 0.964 | |
| filter_coverage | 2.907 | 0.084 | 5.271 | |
| find_barcode | 0.438 | 0.060 | 0.907 | |
| find_bin | 0.003 | 0.004 | 0.017 | |
| find_isoform | 4.157 | 0.129 | 5.397 | |
| find_variants | 5.089 | 0.034 | 5.405 | |
| get_GRangesList | 4.339 | 0.132 | 5.227 | |
| get_coverage | 2.665 | 0.082 | 3.839 | |
| minimap2_align | 3.964 | 0.113 | 4.453 | |
| minimap2_realign | 0.478 | 0.024 | 0.550 | |
| parse_gff_tree | 0.133 | 0.008 | 0.182 | |
| plot_coverage | 4.370 | 0.092 | 5.379 | |
| plot_demultiplex | 0.851 | 0.036 | 1.685 | |
| plot_isoform_heatmap | 3.000 | 0.046 | 3.462 | |
| plot_isoform_reduced_dim | 19.626 | 0.176 | 22.431 | |
| plot_isoforms | 1.981 | 0.006 | 2.876 | |
| quantify_transcript | 1.497 | 0.017 | 2.825 | |
| quantify_transcript_flames | 1.571 | 0.015 | 3.124 | |
| relative_mutation_positions | 6.447 | 0.054 | 7.822 | |
| sc_DTU_analysis | 1.880 | 1.960 | 5.082 | |
| sc_impute_transcript | 0.453 | 0.077 | 0.533 | |
| sc_long_multisample_pipeline | 5.185 | 5.038 | 11.159 | |
| sc_long_pipeline | 1.168 | 1.301 | 2.592 | |
| sc_mutations | 2.152 | 0.399 | 3.500 | |
| weight_transcripts | 0.015 | 0.004 | 0.019 | |