| Back to Multiple platform build/check report for BioC 3.21: simplified long |
|
This page was generated on 2025-02-05 11:39 -0500 (Wed, 05 Feb 2025).
| Hostname | OS | Arch (*) | R version | Installed pkgs |
|---|---|---|---|---|
| nebbiolo1 | Linux (Ubuntu 24.04.1 LTS) | x86_64 | R Under development (unstable) (2025-01-20 r87609) -- "Unsuffered Consequences" | 4717 |
| palomino7 | Windows Server 2022 Datacenter | x64 | R Under development (unstable) (2025-01-21 r87610 ucrt) -- "Unsuffered Consequences" | 4478 |
| lconway | macOS 12.7.1 Monterey | x86_64 | R Under development (unstable) (2025-01-22 r87618) -- "Unsuffered Consequences" | 4489 |
| kjohnson3 | macOS 13.7.1 Ventura | arm64 | R Under development (unstable) (2025-01-20 r87609) -- "Unsuffered Consequences" | 4442 |
| Click on any hostname to see more info about the system (e.g. compilers) (*) as reported by 'uname -p', except on Windows and Mac OS X | ||||
| Package 458/2295 | Hostname | OS / Arch | INSTALL | BUILD | CHECK | BUILD BIN | ||||||||
| CRISPRseek 1.47.1 (landing page) Lihua Julie Zhu
| nebbiolo1 | Linux (Ubuntu 24.04.1 LTS) / x86_64 | OK | OK | ERROR | |||||||||
| palomino7 | Windows Server 2022 Datacenter / x64 | OK | OK | TIMEOUT | OK | |||||||||
| lconway | macOS 12.7.1 Monterey / x86_64 | OK | OK | ERROR | OK | |||||||||
| kjohnson3 | macOS 13.7.1 Ventura / arm64 | OK | OK | ERROR | OK | |||||||||
|
To the developers/maintainers of the CRISPRseek package: - Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/CRISPRseek.git to reflect on this report. See Troubleshooting Build Report for more information. - Use the following Renviron settings to reproduce errors and warnings. - If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information. |
| Package: CRISPRseek |
| Version: 1.47.1 |
| Command: /home/biocbuild/bbs-3.21-bioc/R/bin/R CMD check --install=check:CRISPRseek.install-out.txt --library=/home/biocbuild/bbs-3.21-bioc/R/site-library --timings CRISPRseek_1.47.1.tar.gz |
| StartedAt: 2025-02-04 21:16:18 -0500 (Tue, 04 Feb 2025) |
| EndedAt: 2025-02-04 21:45:38 -0500 (Tue, 04 Feb 2025) |
| EllapsedTime: 1759.1 seconds |
| RetCode: 1 |
| Status: ERROR |
| CheckDir: CRISPRseek.Rcheck |
| Warnings: NA |
##############################################################################
##############################################################################
###
### Running command:
###
### /home/biocbuild/bbs-3.21-bioc/R/bin/R CMD check --install=check:CRISPRseek.install-out.txt --library=/home/biocbuild/bbs-3.21-bioc/R/site-library --timings CRISPRseek_1.47.1.tar.gz
###
##############################################################################
##############################################################################
* using log directory ‘/home/biocbuild/bbs-3.21-bioc/meat/CRISPRseek.Rcheck’
* using R Under development (unstable) (2025-01-20 r87609)
* using platform: x86_64-pc-linux-gnu
* R was compiled by
gcc (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0
GNU Fortran (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0
* running under: Ubuntu 24.04.1 LTS
* using session charset: UTF-8
* checking for file ‘CRISPRseek/DESCRIPTION’ ... OK
* this is package ‘CRISPRseek’ version ‘1.47.1’
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... OK
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... OK
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘CRISPRseek’ can be installed ... OK
* checking installed package size ... INFO
installed size is 13.0Mb
sub-directories of 1Mb or more:
extdata 12.5Mb
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking code files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking loading without being on the library search path ... OK
* checking dependencies in R code ... WARNING
'loadNamespace' or 'requireNamespace' call not declared from: ‘GeneRfold’
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... NOTE
annotateOffTargets: no visible global function definition for
‘seqlevels<-’
getOfftargetScore2: no visible binding for global variable ‘subPAM’
predictRelativeFreqIndels : <anonymous>: no visible global function
definition for ‘predIndelFreq’
prepCasOFFinderBulge: no visible binding for global variable
‘cas_offinder_bulge’
Undefined global functions or variables:
cas_offinder_bulge predIndelFreq seqlevels<- subPAM
* checking Rd files ... NOTE
prepare_Rd: annotateOffTargets.Rd:64-66: Dropping empty section \details
checkRd: (-1) annotateOffTargets.Rd:13-14: Lost braces
13 | \item{strand} - {strand of the off target ((+) for plus and (-) for minus
| ^
checkRd: (-1) annotateOffTargets.Rd:15: Lost braces; missing escapes or markup?
15 | \item{chrom} - {chromosome of the off target}
| ^
checkRd: (-1) annotateOffTargets.Rd:16-17: Lost braces
16 | \item{chromStart} - {start position of
| ^
checkRd: (-1) annotateOffTargets.Rd:18: Lost braces; missing escapes or markup?
18 | \item{chromEnd} - {end position of the off target}
| ^
checkRd: (-1) annotateOffTargets.Rd:19-20: Lost braces
19 | \item{name} - {gRNA
| ^
checkRd: (-1) annotateOffTargets.Rd:21: Lost braces; missing escapes or markup?
21 | \item{gRNAPlusPAM} - {gRNA sequence with PAM sequence concatenated}
| ^
checkRd: (-1) annotateOffTargets.Rd:22: Lost braces; missing escapes or markup?
22 | \item{OffTargetSequence} - {the genomic sequence of the off target}
| ^
checkRd: (-1) annotateOffTargets.Rd:23: Lost braces; missing escapes or markup?
23 | \item{n.mismatch} - {number of mismatches between the off target and the gRNA}
| ^
checkRd: (-1) annotateOffTargets.Rd:24: Lost braces; missing escapes or markup?
24 | \item{forViewInUCSC} - {string for viewing in UCSC genome browser, e.g., chr14:31665685-31665707}
| ^
checkRd: (-1) annotateOffTargets.Rd:25: Lost braces; missing escapes or markup?
25 | \item{score} - {score of the off target}
| ^
checkRd: (-1) annotateOffTargets.Rd:26-28: Lost braces
26 | \item{mismatch.distance2PAM} - {a comma separated
| ^
checkRd: (-1) annotateOffTargets.Rd:29-31: Lost braces
29 | \item{alignment} - {alignment between gRNA and off target, e.g., ......G..C.......... means
| ^
checkRd: (-1) annotateOffTargets.Rd:32-33: Lost braces
32 | \item{NGG} - {this off target contains canonical PAM or not, 1 for yes
| ^
checkRd: (-1) annotateOffTargets.Rd:34-35: Lost braces
34 | \item{mean.neighbor.distance.mismatch} - {mean distance between
| ^
checkRd: (-1) annotateOffTargets.Rd:45: Lost braces; missing escapes or markup?
45 | \item{TxDb.Rnorvegicus.UCSC.rn5.refGene} - {for rat}
| ^
checkRd: (-1) annotateOffTargets.Rd:46: Lost braces; missing escapes or markup?
46 | \item{TxDb.Mmusculus.UCSC.mm10.knownGene} - {for mouse}
| ^
checkRd: (-1) annotateOffTargets.Rd:47: Lost braces; missing escapes or markup?
47 | \item{TxDb.Hsapiens.UCSC.hg19.knownGene} - {for human}
| ^
checkRd: (-1) annotateOffTargets.Rd:48: Lost braces; missing escapes or markup?
48 | \item{TxDb.Dmelanogaster.UCSC.dm3.ensGene} - {for Drosophila}
| ^
checkRd: (-1) annotateOffTargets.Rd:49: Lost braces; missing escapes or markup?
49 | \item{TxDb.Celegans.UCSC.ce6.ensGene} - {for C.elegans}
| ^
prepare_Rd: buildFeatureVectorForScoring.Rd:86-88: Dropping empty section \details
checkRd: (-1) buildFeatureVectorForScoring.Rd:19-21: Lost braces
19 | \item{IsMismatch.posX} - {Indicator variable indicating whether this position X is
| ^
checkRd: (-1) buildFeatureVectorForScoring.Rd:22-23: Lost braces
22 | \item{strand} - {strand of the
| ^
checkRd: (-1) buildFeatureVectorForScoring.Rd:24-25: Lost braces
24 | \item{chrom} - {chromosome of the off
| ^
checkRd: (-1) buildFeatureVectorForScoring.Rd:26: Lost braces; missing escapes or markup?
26 | \item{chromStart} - {start position of the off target}
| ^
checkRd: (-1) buildFeatureVectorForScoring.Rd:27-28: Lost braces
27 | \item{chromEnd} - {end
| ^
checkRd: (-1) buildFeatureVectorForScoring.Rd:29: Lost braces; missing escapes or markup?
29 | \item{name} - {gRNA name}
| ^
checkRd: (-1) buildFeatureVectorForScoring.Rd:30-31: Lost braces
30 | \item{gRNAPlusPAM} - {gRNA sequence
| ^
checkRd: (-1) buildFeatureVectorForScoring.Rd:32-33: Lost braces
32 | \item{OffTargetSequence} - {the genomic sequence of
| ^
checkRd: (-1) buildFeatureVectorForScoring.Rd:34-35: Lost braces
34 | \item{n.mismatch} - {number of mismatches between the off target and
| ^
checkRd: (-1) buildFeatureVectorForScoring.Rd:36-37: Lost braces
36 | \item{forViewInUCSC} - {string for viewing in UCSC genome browser, e.g.,
| ^
checkRd: (-1) buildFeatureVectorForScoring.Rd:38-39: Lost braces
38 | \item{score} - {Set to 100, and will be calculated in
| ^
checkRd: (-1) buildFeatureVectorForScoring.Rd:59-61: Lost braces
59 | \item{IsMismatch.posX} - {Indicator variable
| ^
checkRd: (-1) buildFeatureVectorForScoring.Rd:62: Lost braces; missing escapes or markup?
62 | \item{strand} - {strand of the off target, + for plus and - for minus strand}
| ^
checkRd: (-1) buildFeatureVectorForScoring.Rd:63: Lost braces; missing escapes or markup?
63 | \item{chrom} - {chromosome of the off target}
| ^
checkRd: (-1) buildFeatureVectorForScoring.Rd:64-65: Lost braces
64 | \item{chromStart} - {start position of the off
| ^
checkRd: (-1) buildFeatureVectorForScoring.Rd:66: Lost braces; missing escapes or markup?
66 | \item{chromEnd} - {end position of the off target}
| ^
checkRd: (-1) buildFeatureVectorForScoring.Rd:67: Lost braces; missing escapes or markup?
67 | \item{name} - {gRNA name}
| ^
checkRd: (-1) buildFeatureVectorForScoring.Rd:68: Lost braces; missing escapes or markup?
68 | \item{gRNAPlusPAM} - {gRNA sequence with PAM sequence concatenated}
| ^
checkRd: (-1) buildFeatureVectorForScoring.Rd:69: Lost braces; missing escapes or markup?
69 | \item{OffTargetSequence} - {the genomic sequence of the off target}
| ^
checkRd: (-1) buildFeatureVectorForScoring.Rd:70: Lost braces; missing escapes or markup?
70 | \item{n.mismatch} - {number of mismatches between the off target and the gRNA}
| ^
checkRd: (-1) buildFeatureVectorForScoring.Rd:71: Lost braces; missing escapes or markup?
71 | \item{forViewInUCSC} - {string for viewing in UCSC genome browser, e.g., chr14:31665685-31665707}
| ^
checkRd: (-1) buildFeatureVectorForScoring.Rd:72: Lost braces; missing escapes or markup?
72 | \item{score} - {score of the off target}
| ^
checkRd: (-1) buildFeatureVectorForScoring.Rd:73-75: Lost braces
73 | \item{mismatche.distance2PAM} - {a comma separated
| ^
checkRd: (-1) buildFeatureVectorForScoring.Rd:76-77: Lost braces
76 | \item{alignment} - {alignment between gRNA and off target, e.g., ......G..C.......... means
| ^
checkRd: (-1) buildFeatureVectorForScoring.Rd:78: Lost braces; missing escapes or markup?
78 | \item{NGG} - {this off target contains canonical PAM or not, 1 for yes and 0 for no}
| ^
checkRd: (-1) buildFeatureVectorForScoring.Rd:79-80: Lost braces
79 | \item{mean.neighbor.distance.mismatch} - {mean distance between neighboring
| ^
checkRd: (-1) calculategRNAEfficiency.Rd:30-31: Lost braces
30 | \item{GC_LOW} - {penalty for low
| ^
checkRd: (-1) calculategRNAEfficiency.Rd:32-33: Lost braces
32 | \item{GC_HIGH} - {penalty for high GC content in
| ^
checkRd: (-1) calculategRNAEfficiency.Rd:34-35: Lost braces
34 | \item{G02} - {means G at second position of the
| ^
checkRd: (-1) calculategRNAEfficiency.Rd:36-37: Lost braces
36 | \item{GT02} - {means GT di-nucleotides starting at 2nd position of
| ^
prepare_Rd: compare2Sequences.Rd:257-259: Dropping empty section \details
prepare_Rd: compare2Sequences.Rd:260-262: Dropping empty section \note
prepare_Rd: filterOffTarget.Rd:154-156: Dropping empty section \details
prepare_Rd: filterOffTarget.Rd:157-159: Dropping empty section \note
checkRd: (-1) filterOffTarget.Rd:37: Lost braces; missing escapes or markup?
37 | \item{strand} - {strand of the off target, + for plus and - for minus strand}
| ^
checkRd: (-1) filterOffTarget.Rd:38: Lost braces; missing escapes or markup?
38 | \item{chrom} - {chromosome of the off target}
| ^
checkRd: (-1) filterOffTarget.Rd:39: Lost braces; missing escapes or markup?
39 | \item{chromStart} - {start position of the offtarget}
| ^
checkRd: (-1) filterOffTarget.Rd:40: Lost braces; missing escapes or markup?
40 | \item{chromEnd} - {end position of the offtarget}
| ^
checkRd: (-1) filterOffTarget.Rd:41: Lost braces; missing escapes or markup?
41 | \item{name} - {gRNA name}
| ^
checkRd: (-1) filterOffTarget.Rd:42: Lost braces; missing escapes or markup?
42 | \item{gRNAPlusPAM} - {gRNA sequence with PAM sequence concatenated}
| ^
checkRd: (-1) filterOffTarget.Rd:43: Lost braces; missing escapes or markup?
43 | \item{OffTargetSequence} - {the genomic sequence of the off target}
| ^
checkRd: (-1) filterOffTarget.Rd:44: Lost braces; missing escapes or markup?
44 | \item{n.mismatch} - {number of mismatches between the off target and the gRNA}
| ^
checkRd: (-1) filterOffTarget.Rd:45: Lost braces; missing escapes or markup?
45 | \item{forViewInUCSC} - {string for viewing in UCSC genome browser, e.g., chr14:31665685-31665707}
| ^
checkRd: (-1) filterOffTarget.Rd:46: Lost braces; missing escapes or markup?
46 | \item{score} - {score of the off target}
| ^
checkRd: (-1) filterOffTarget.Rd:47-49: Lost braces
47 | \item{mismatch.distance2PAM} - {a comma separated
| ^
checkRd: (-1) filterOffTarget.Rd:50-52: Lost braces
50 | \item{alignment} - {alignment between gRNA and off target, e.g., ......G..C.......... means
| ^
checkRd: (-1) filterOffTarget.Rd:53-54: Lost braces
53 | \item{NGG} - {this off target contains canonical PAM or not, 1 for yes
| ^
checkRd: (-1) filterOffTarget.Rd:55-56: Lost braces
55 | \item{mean.neighbor.distance.mismatch} - {mean distance between
| ^
checkRd: (-1) filterOffTarget.Rd:101: Lost braces; missing escapes or markup?
101 | \item{BSgenome.Hsapiens.UCSC.hg19} - {for hg19}
| ^
checkRd: (-1) filterOffTarget.Rd:102: Lost braces; missing escapes or markup?
102 | \item{BSgenome.Mmusculus.UCSC.mm10} - {for mm10}
| ^
checkRd: (-1) filterOffTarget.Rd:103: Lost braces; missing escapes or markup?
103 | \item{BSgenome.Celegans.UCSC.ce6} - {for ce6}
| ^
checkRd: (-1) filterOffTarget.Rd:104: Lost braces; missing escapes or markup?
104 | \item{BSgenome.Rnorvegicus.UCSC.rn5} - {for rn5}
| ^
checkRd: (-1) filterOffTarget.Rd:105: Lost braces; missing escapes or markup?
105 | \item{BSgenome.Dmelanogaster.UCSC.dm3} - {for dm3}
| ^
prepare_Rd: filtergRNAs.Rd:48-50: Dropping empty section \details
prepare_Rd: filtergRNAs.Rd:51-53: Dropping empty section \note
prepare_Rd: filtergRNAs.Rd:74-76: Dropping empty section \references
prepare_Rd: findgRNAs.Rd:319-321: Dropping empty section \references
prepare_Rd: getOfftargetScore.Rd:79-81: Dropping empty section \note
checkRd: (-1) getOfftargetScore.Rd:17-19: Lost braces
17 | \item{IsMismatch.posX} - {Indicator variable
| ^
checkRd: (-1) getOfftargetScore.Rd:20: Lost braces; missing escapes or markup?
20 | \item{strand} - {strand of the off target, + for plus and - for minus strand}
| ^
checkRd: (-1) getOfftargetScore.Rd:21: Lost braces; missing escapes or markup?
21 | \item{chrom} - {chromosome of the off target}
| ^
checkRd: (-1) getOfftargetScore.Rd:22-23: Lost braces
22 | \item{chromStart} - {start position of the off
| ^
checkRd: (-1) getOfftargetScore.Rd:24: Lost braces; missing escapes or markup?
24 | \item{chromEnd} - {end position of the off target}
| ^
checkRd: (-1) getOfftargetScore.Rd:25: Lost braces; missing escapes or markup?
25 | \item{name} - {gRNA name}
| ^
checkRd: (-1) getOfftargetScore.Rd:26: Lost braces; missing escapes or markup?
26 | \item{gRNAPlusPAM} - {gRNA sequence with PAM sequence concatenated}
| ^
checkRd: (-1) getOfftargetScore.Rd:27: Lost braces; missing escapes or markup?
27 | \item{OffTargetSequence} - {the genomic sequence of the off target}
| ^
checkRd: (-1) getOfftargetScore.Rd:28: Lost braces; missing escapes or markup?
28 | \item{n.mismatch} - {number of mismatches between the off target and the gRNA}
| ^
checkRd: (-1) getOfftargetScore.Rd:29: Lost braces; missing escapes or markup?
29 | \item{forViewInUCSC} - {string for viewing in UCSC genome browser, e.g., chr14:31665685-31665707}
| ^
checkRd: (-1) getOfftargetScore.Rd:30: Lost braces; missing escapes or markup?
30 | \item{score} - {score of the off target}
| ^
checkRd: (-1) getOfftargetScore.Rd:31-33: Lost braces
31 | \item{mismatche.distance2PAM} - {a comma separated
| ^
checkRd: (-1) getOfftargetScore.Rd:34-35: Lost braces
34 | \item{alignment} - {alignment between gRNA and off target, e.g., ......G..C.......... means
| ^
checkRd: (-1) getOfftargetScore.Rd:36: Lost braces; missing escapes or markup?
36 | \item{NGG} - {this off target contains canonical PAM or not, 1 for yes and 0 for no}
| ^
checkRd: (-1) getOfftargetScore.Rd:37-38: Lost braces
37 | \item{mean.neighbor.distance.mismatch} - {mean distance between neighboring
| ^
checkRd: (-1) getOfftargetScore.Rd:49-50: Lost braces
49 | {strand} - {strand of the match, + for plus and
| ^
checkRd: (-1) getOfftargetScore.Rd:51: Lost braces; missing escapes or markup?
51 | \item{chrom} - {chromosome of the off target}
| ^
checkRd: (-1) getOfftargetScore.Rd:52-53: Lost braces
52 | \item{chromStart} - {start
| ^
checkRd: (-1) getOfftargetScore.Rd:54: Lost braces; missing escapes or markup?
54 | \item{chromEnd} - {end position of the off target}
| ^
checkRd: (-1) getOfftargetScore.Rd:55: Lost braces; missing escapes or markup?
55 | \item{name} - {gRNA name}
| ^
checkRd: (-1) getOfftargetScore.Rd:56: Lost braces; missing escapes or markup?
56 | \item{gRNAPlusPAM} - {gRNA sequence with PAM sequence concatenated}
| ^
checkRd: (-1) getOfftargetScore.Rd:57: Lost braces; missing escapes or markup?
57 | \item{OffTargetSequence} - {the genomic sequence of the off target}
| ^
checkRd: (-1) getOfftargetScore.Rd:58: Lost braces; missing escapes or markup?
58 | \item{n.mismatch} - {number of mismatches between the off target and the gRNA}
| ^
checkRd: (-1) getOfftargetScore.Rd:59: Lost braces; missing escapes or markup?
59 | \item{forViewInUCSC} - {string for viewing in UCSC genome browser, e.g., chr14:31665685-31665707}
| ^
checkRd: (-1) getOfftargetScore.Rd:60: Lost braces; missing escapes or markup?
60 | \item{score} - {score of the off target}
| ^
checkRd: (-1) getOfftargetScore.Rd:61-63: Lost braces
61 | \item{mismatch.distance2PAM} - {a comma separated
| ^
checkRd: (-1) getOfftargetScore.Rd:64-65: Lost braces
64 | \item{alignment} - {alignment between gRNA and off target, e.g., ......G..C.......... means
| ^
checkRd: (-1) getOfftargetScore.Rd:66: Lost braces; missing escapes or markup?
66 | \item{NGG} - {this off target contains canonical PAM or not, 1 for yes and 0 for no}
| ^
checkRd: (-1) getOfftargetScore.Rd:67-68: Lost braces
67 | \item{mean.neighbor.distance.mismatch} - {mean distance between neighboring
| ^
prepare_Rd: isPatternUnique.Rd:23-25: Dropping empty section \details
prepare_Rd: isPatternUnique.Rd:26-28: Dropping empty section \note
prepare_Rd: isPatternUnique.Rd:35-37: Dropping empty section \references
prepare_Rd: offTargetAnalysis.Rd:461-463: Dropping empty section \details
prepare_Rd: offTargetAnalysis.Rd:464-466: Dropping empty section \note
prepare_Rd: searchHits.Rd:99-101: Dropping empty section \details
prepare_Rd: searchHits.Rd:102-104: Dropping empty section \note
prepare_Rd: searchHits.Rd:130-132: Dropping empty section \references
checkRd: (-1) searchHits.Rd:74-75: Lost braces
74 | \item{IsMismatch.posX} - {indicator variable indicating
| ^
checkRd: (-1) searchHits.Rd:76-77: Lost braces
76 | \item{strand} - {strand of
| ^
checkRd: (-1) searchHits.Rd:78-79: Lost braces
78 | \item{chrom} - {chromosome of the off
| ^
checkRd: (-1) searchHits.Rd:80: Lost braces; missing escapes or markup?
80 | \item{chromStart} - {start position of the off target}
| ^
checkRd: (-1) searchHits.Rd:81-82: Lost braces
81 | \item{chromEnd} - {end
| ^
checkRd: (-1) searchHits.Rd:83: Lost braces; missing escapes or markup?
83 | \item{name} - {gRNA name}
| ^
checkRd: (-1) searchHits.Rd:84-85: Lost braces
84 | \item{gRNAPlusPAM} - {gRNA sequence
| ^
checkRd: (-1) searchHits.Rd:86-87: Lost braces
86 | \item{OffTargetSequence} - {the genomic sequence of
| ^
checkRd: (-1) searchHits.Rd:88-89: Lost braces
88 | \item{n.mismatch} - {number of mismatches between the off target and
| ^
checkRd: (-1) searchHits.Rd:90-91: Lost braces
90 | \item{forViewInUCSC} - {string for viewing in UCSC genome browser, e.g.,
| ^
checkRd: (-1) searchHits.Rd:92-93: Lost braces
92 | \item{score} - {set to 100, and will be updated in
| ^
prepare_Rd: searchHits2.Rd:116-118: Dropping empty section \details
prepare_Rd: searchHits2.Rd:119-121: Dropping empty section \note
prepare_Rd: searchHits2.Rd:152-154: Dropping empty section \references
checkRd: (-1) searchHits2.Rd:90-92: Lost braces
90 | \item{IsMismatch.posX} - {indicator variable indicating
| ^
checkRd: (-1) searchHits2.Rd:93-94: Lost braces
93 | \item{strand} - {strand of
| ^
checkRd: (-1) searchHits2.Rd:95-96: Lost braces
95 | \item{chrom} - {chromosome of the off
| ^
checkRd: (-1) searchHits2.Rd:97: Lost braces; missing escapes or markup?
97 | \item{chromStart} - {start position of the off target}
| ^
checkRd: (-1) searchHits2.Rd:98-99: Lost braces
98 | \item{chromEnd} - {end
| ^
checkRd: (-1) searchHits2.Rd:100: Lost braces; missing escapes or markup?
100 | \item{name} - {gRNA name}
| ^
checkRd: (-1) searchHits2.Rd:101-102: Lost braces
101 | \item{gRNAPlusPAM} - {gRNA sequence
| ^
checkRd: (-1) searchHits2.Rd:103-104: Lost braces
103 | \item{OffTargetSequence} - {the genomic sequence of
| ^
checkRd: (-1) searchHits2.Rd:105-106: Lost braces
105 | \item{n.mismatch} - {number of mismatches between the off target and
| ^
checkRd: (-1) searchHits2.Rd:107-108: Lost braces
107 | \item{forViewInUCSC} - {string for viewing in UCSC genome browser, e.g.,
| ^
checkRd: (-1) searchHits2.Rd:109-110: Lost braces
109 | \item{score} - {set to 100, and will be updated in
| ^
prepare_Rd: translatePattern.Rd:22-24: Dropping empty section \details
prepare_Rd: translatePattern.Rd:25-27: Dropping empty section \note
prepare_Rd: translatePattern.Rd:33-35: Dropping empty section \references
prepare_Rd: translatePattern.Rd:36-38: Dropping empty section \seealso
prepare_Rd: uniqueREs.Rd:46-48: Dropping empty section \details
prepare_Rd: uniqueREs.Rd:49-51: Dropping empty section \note
prepare_Rd: uniqueREs.Rd:61-63: Dropping empty section \references
checkRd: (-1) uniqueREs.Rd:30: Lost braces; missing escapes or markup?
30 | \item{BSgenome.Hsapiens.UCSC.hg19} - {for hg19}
| ^
checkRd: (-1) uniqueREs.Rd:31: Lost braces; missing escapes or markup?
31 | \item{BSgenome.Mmusculus.UCSC.mm10} - {for mm10}
| ^
checkRd: (-1) uniqueREs.Rd:32: Lost braces; missing escapes or markup?
32 | \item{BSgenome.Celegans.UCSC.ce6} - {for ce6}
| ^
checkRd: (-1) uniqueREs.Rd:33: Lost braces; missing escapes or markup?
33 | \item{BSgenome.Rnorvegicus.UCSC.rn5} - {for rn5}
| ^
checkRd: (-1) uniqueREs.Rd:34: Lost braces; missing escapes or markup?
34 | \item{BSgenome.Drerio.UCSC.danRer7} - {for Zv9}
| ^
checkRd: (-1) uniqueREs.Rd:35: Lost braces; missing escapes or markup?
35 | \item{BSgenome.Dmelanogaster.UCSC.dm3} - {for dm3}
| ^
prepare_Rd: writeHits.Rd:89-91: Dropping empty section \details
prepare_Rd: writeHits.Rd:92-94: Dropping empty section \note
prepare_Rd: writeHits2.Rd:99-101: Dropping empty section \details
prepare_Rd: writeHits2.Rd:102-104: Dropping empty section \note
checkRd: (-1) writeHits2.Rd:68: Lost braces; missing escapes or markup?
68 | \item{BSgenome.Hsapiens.UCSC.hg19} - {for hg19}
| ^
checkRd: (-1) writeHits2.Rd:69: Lost braces; missing escapes or markup?
69 | \item{BSgenome.Mmusculus.UCSC.mm10} - {for mm10}
| ^
checkRd: (-1) writeHits2.Rd:70: Lost braces; missing escapes or markup?
70 | \item{BSgenome.Celegans.UCSC.ce6} - {for ce6}
| ^
checkRd: (-1) writeHits2.Rd:71: Lost braces; missing escapes or markup?
71 | \item{BSgenome.Rnorvegicus.UCSC.rn5} - {for rn5}
| ^
checkRd: (-1) writeHits2.Rd:72: Lost braces; missing escapes or markup?
72 | \item{BSgenome.Drerio.UCSC.danRer7} - {for Zv9}
| ^
checkRd: (-1) writeHits2.Rd:73: Lost braces; missing escapes or markup?
73 | \item{BSgenome.Dmelanogaster.UCSC.dm3} - {for dm3}
| ^
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking files in ‘vignettes’ ... OK
* checking examples ... ERROR
Running examples in ‘CRISPRseek-Ex.R’ failed
The error most likely occurred in:
> base::assign(".ptime", proc.time(), pos = "CheckExEnv")
> ### Name: findgRNAs
> ### Title: Find potential gRNAs
> ### Aliases: findgRNAs
> ### Keywords: misc
>
> ### ** Examples
>
>
> # Example1: DNAStringSet as input, only output paired gRNAs
> inputSeq <- DNAStringSet(paste0("CCAGTTTGTGGATCCTGCTCTGGTGTC",
+ "CTCCACACCAGAATCAGGGATCGAAAA",
+ "CTCATCAGTCGATGCGAGTCATCTAAA",
+ "TTCCGATCAATTTCACACTTTAAACG"))
> findgRNAs(inputFilePath = inputSeq,
+ findPairedgRNAOnly = TRUE,
+ pairOutputFile = "test_findgRNAs1.xlsx",
+ PAM.size = 3L,
+ gRNA.size = 20L,
+ overlap.gRNA.positions = c(17L,18L),
+ PBS.length = 15,
+ corrected.seq = "T",
+ RT.template.pattern = "D$",
+ RT.template.length = 8:30,
+ targeted.seq.length.change = 0,
+ bp.after.target.end = 15,
+ target.start = 46,
+ target.end = 46,
+ paired.orientation = "PAMin",
+ min.gap = 20,
+ max.gap = 90,
+ primeEditing = TRUE)
DNAStringSet object of length 3:
width seq names
[1] 23 GTGTCCTCCACACCAGAATCAGG NA_gR39f
[2] 23 TGTCCTCCACACCAGAATCAGGG NA_gR40f
[3] 23 GTTTAAAGTGTGAAATTGATCGG NA_gR90r
>
> # Example2: FASTA as input, only output paired gRNAs
> findgRNAs(inputFilePath = system.file("extdata",
+ "inputseq.fa",
+ package = "CRISPRseek"),
+ findPairedgRNAOnly = TRUE,
+ pairOutputFile = "test_findgRNAs2.xlsx")
DNAStringSet object of length 3:
width seq names
[1] 23 GTGTCCTCCACACCAGAATCAGG Hsap_GATA1_ex2_gR39f
[2] 23 TGTCCTCCACACCAGAATCAGGG Hsap_GATA1_ex2_gR40f
[3] 23 CCAGAGCAGGATCCACAAACTGG Hsap_GATA1_ex2_gR7r
>
> # Example3: predict gRNA efficacy using CRISPRscan
> featureWeightMatrixFile <- system.file("extdata",
+ "Morenos-Mateo.csv",
+ package = "CRISPRseek")
> findgRNAs(inputFilePath = system.file("extdata",
+ "testCRISPRscan.fa",
+ package = "CRISPRseek"),
+ pairOutputFile = "test_findgRNAs3.xlsx",
+ findPairedgRNAOnly = FALSE,
+ calculategRNAEfficacy= TRUE,
+ rule.set = "CRISPRscan",
+ baseBeforegRNA = 6,
+ baseAfterPAM = 6,
+ featureWeightMatrixFile = featureWeightMatrixFile,
+ efficacyFile = "testCRISPRscanEfficacy.xlsx")
DNAStringSet object of length 10:
width seq names
[1] 23 ATCCATGGAGCAGTACCAGGTGG gRNA1test:crisprS...
[2] 23 GGAGCAGTACCAGGTGGACTCGG gRNA1test:crisprS...
[3] 23 GTCCACCTGGTACTGCTCCATGG gRNA1test:crisprS...
[4] 23 AGAGGACTGTTTGGACAACATGG gRNA2test:risprSc...
[5] 23 CTGTTTGGACAACATGGAAGCGG gRNA2test:risprSc...
[6] 23 AACATGGAAGCGGCTGTTTTTGG gRNA3test-crisprS...
[7] 23 GGAAGCGGCTGTTTTTGGAGTGG gRNA3test-crisprS...
[8] 23 AGCGGCTGTTTTTGGAGTGGTGG gRNA3test-crisprS...
[9] 23 GGAAGCGGCTGTTTTTGGAGTGG gRNA4test:crisprS...
[10] 23 AGCGGCTGTTTTTGGAGTGGTGG gRNA4test:crisprS...
>
> # Example 4: predict gRNA efficacy using DeepCpf1
> findgRNAs(inputFilePath = system.file("extdata",
+ "cpf1.fa",
+ package = "CRISPRseek"),
+ findPairedgRNAOnly = FALSE,
+ pairOutputFile = "test_findgRNAs_cpf1.xlsx",
+ PAM = "TTTN",
+ PAM.location = "5prime",
+ PAM.size = 4,
+ overlap.gRNA.positions = c(19, 23),
+ baseBeforegRNA = 8,
+ baseAfterPAM = 26,
+ calculategRNAEfficacy = TRUE,
+ rule.set = "DeepCpf1",
+ efficacyFile = "testcpf1Efficacy.xlsx")
Error: Valid installation of TensorFlow not found.
Python environments searched for 'tensorflow' package:
/usr/bin/python3.12
Python exception encountered:
Traceback (most recent call last):
File "/home/biocbuild/bbs-3.21-bioc/R/site-library/reticulate/python/rpytools/loader.py", line 122, in _find_and_load_hook
return _run_hook(name, _hook)
^^^^^^^^^^^^^^^^^^^^^^
File "/home/biocbuild/bbs-3.21-bioc/R/site-library/reticulate/python/rpytools/loader.py", line 96, in _run_hook
module = hook()
^^^^^^
File "/home/biocbuild/bbs-3.21-bioc/R/site-library/reticulate/python/rpytools/loader.py", line 120, in _hook
return _find_and_load(name, import_)
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
File "/home/biocbuild/.virtualenvs/r-reticulate/lib/python3.12/site-packages/tensorflow/__init__.py", line 30, in <module>
import distutils as _distutils
File "/home/biocbuild/bbs-3.21-bioc/R/site-library/reticulate/python/rpytools/loader.py", line 122, in
Execution halted
Examples with CPU (user + system) or elapsed time > 5s
user system elapsed
compare2Sequences 7.280 0.476 7.748
annotateOffTargets 5.879 0.352 6.492
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
Running ‘testthat.R’
OK
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes ... OK
* checking re-building of vignette outputs ... OK
* checking PDF version of manual ... OK
* DONE
Status: 1 ERROR, 1 WARNING, 2 NOTEs
See
‘/home/biocbuild/bbs-3.21-bioc/meat/CRISPRseek.Rcheck/00check.log’
for details.
CRISPRseek.Rcheck/00install.out
############################################################################## ############################################################################## ### ### Running command: ### ### /home/biocbuild/bbs-3.21-bioc/R/bin/R CMD INSTALL CRISPRseek ### ############################################################################## ############################################################################## * installing to library ‘/home/biocbuild/bbs-3.21-bioc/R/site-library’ * installing *source* package ‘CRISPRseek’ ... ** this is package ‘CRISPRseek’ version ‘1.47.1’ ** using staged installation ** R ** inst ** byte-compile and prepare package for lazy loading ** help *** installing help indices ** building package indices ** installing vignettes ** testing if installed package can be loaded from temporary location ** testing if installed package can be loaded from final location ** testing if installed package keeps a record of temporary installation path * DONE (CRISPRseek)
CRISPRseek.Rcheck/tests/testthat.Rout
R Under development (unstable) (2025-01-20 r87609) -- "Unsuffered Consequences"
Copyright (C) 2025 The R Foundation for Statistical Computing
Platform: x86_64-pc-linux-gnu
R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.
R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.
Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.
> dependencies <- c("CRISPRseek",
+ "BSgenome.Hsapiens.UCSC.hg19",
+ "org.Hs.eg.db",
+ "TxDb.Hsapiens.UCSC.hg19.knownGene",
+ "BSgenome.Mmusculus.UCSC.mm10",
+ "org.Mm.eg.db",
+ "TxDb.Mmusculus.UCSC.mm10.knownGene",
+ "testthat")
> sapply(dependencies, function(x) ifelse(do.call(require, list(x)), "okay", abort(x, "is not loaded for unit testing!")))
Loading required package: CRISPRseek
Loading required package: BiocGenerics
Loading required package: generics
Attaching package: 'generics'
The following objects are masked from 'package:base':
as.difftime, as.factor, as.ordered, intersect, is.element, setdiff,
setequal, union
Attaching package: 'BiocGenerics'
The following objects are masked from 'package:stats':
IQR, mad, sd, var, xtabs
The following objects are masked from 'package:base':
Filter, Find, Map, Position, Reduce, anyDuplicated, aperm, append,
as.data.frame, basename, cbind, colnames, dirname, do.call,
duplicated, eval, evalq, get, grep, grepl, is.unsorted, lapply,
mapply, match, mget, order, paste, pmax, pmax.int, pmin, pmin.int,
rank, rbind, rownames, sapply, saveRDS, table, tapply, unique,
unsplit, which.max, which.min
Loading required package: Biostrings
Loading required package: S4Vectors
Loading required package: stats4
Attaching package: 'S4Vectors'
The following object is masked from 'package:utils':
findMatches
The following objects are masked from 'package:base':
I, expand.grid, unname
Loading required package: IRanges
Loading required package: XVector
Loading required package: GenomeInfoDb
Attaching package: 'Biostrings'
The following object is masked from 'package:base':
strsplit
Loading required package: GenomicFeatures
Loading required package: GenomicRanges
Loading required package: AnnotationDbi
Loading required package: Biobase
Welcome to Bioconductor
Vignettes contain introductory material; view with
'browseVignettes()'. To cite Bioconductor, see
'citation("Biobase")', and for packages 'citation("pkgname")'.
Loading required package: BSgenome.Hsapiens.UCSC.hg19
Loading required package: BSgenome
Loading required package: BiocIO
Loading required package: rtracklayer
Attaching package: 'rtracklayer'
The following object is masked from 'package:BiocIO':
FileForFormat
Loading required package: org.Hs.eg.db
Loading required package: TxDb.Hsapiens.UCSC.hg19.knownGene
Loading required package: BSgenome.Mmusculus.UCSC.mm10
Loading required package: org.Mm.eg.db
Loading required package: TxDb.Mmusculus.UCSC.mm10.knownGene
Loading required package: testthat
CRISPRseek BSgenome.Hsapiens.UCSC.hg19
"okay" "okay"
org.Hs.eg.db TxDb.Hsapiens.UCSC.hg19.knownGene
"okay" "okay"
BSgenome.Mmusculus.UCSC.mm10 org.Mm.eg.db
"okay" "okay"
TxDb.Mmusculus.UCSC.mm10.knownGene testthat
"okay" "okay"
> test_check("CRISPRseek")
search for gRNAs for input file1...
search for gRNAs for input file2...
[1] "Scoring ..."
finish off-target search in sequence 2
finish off-target search in sequence 1
finish feature vector building
finish score calculation
[1] "Done!"
search for gRNAs for input file1...
search for gRNAs for input file2...
[1] "Scoring ..."
finish off-target search in sequence 2
finish off-target search in sequence 1
finish feature vector building
finish score calculation
[1] "Done!"
search for gRNAs for input file1...
search for gRNAs for input file2...
[1] "Scoring ..."
finish off-target search in sequence 2
finish off-target search in sequence 1
finish feature vector building
finish score calculation
[1] "Done!"
search for gRNAs for input file1...
[1] "Scoring ..."
finish off-target search in sequence 2
finish off-target search in sequence 1
finish feature vector building
finish score calculation
[1] "Done!"
[1] "Scoring ..."
finish off-target search in sequence 2
finish off-target search in sequence 1
finish feature vector building
finish score calculation
[1] "Done!"
testing gRNAs provided and filter gRNAs with RE for offTargetAnalysis
testing gRNAs provided without filtering gRNAs with RE for offTargetAnalysis
checking N in PAM...[ FAIL 0 | WARN 0 | SKIP 0 | PASS 65 ]
>
>
> proc.time()
user system elapsed
1262.698 45.270 1340.434
CRISPRseek.Rcheck/CRISPRseek-Ex.timings
| name | user | system | elapsed | |
| annotateOffTargets | 5.879 | 0.352 | 6.492 | |
| buildFeatureVectorForScoring | 0.145 | 0.004 | 0.149 | |
| calculategRNAEfficiency | 0.016 | 0.003 | 0.017 | |
| chromToExclude_default | 0.000 | 0.000 | 0.001 | |
| compare2Sequences | 7.280 | 0.476 | 7.748 | |
| deepCpf1 | 0.058 | 0.009 | 0.067 | |
| filterOffTarget | 3.691 | 0.260 | 3.950 | |
| filtergRNAs | 0.633 | 0.056 | 0.690 | |