Back to Multiple platform build/check report for BioC 3.23:   simplified   long
ABCDE[F]GHIJKLMNOPQRSTUVWXYZ

This page was generated on 2026-04-11 11:37 -0400 (Sat, 11 Apr 2026).

HostnameOSArch (*)R versionInstalled pkgs
nebbiolo1Linux (Ubuntu 24.04.4 LTS)x86_644.6.0 alpha (2026-04-05 r89794) 4919
kjohnson3macOS 13.7.7 Venturaarm644.6.0 alpha (2026-04-08 r89818) 4631
Click on any hostname to see more info about the system (e.g. compilers)      (*) as reported by 'uname -p', except on Windows and Mac OS X

Package 753/2390HostnameOS / ArchINSTALLBUILDCHECKBUILD BIN
FLAMES 2.5.3  (landing page)
Changqing Wang
Snapshot Date: 2026-04-10 13:40 -0400 (Fri, 10 Apr 2026)
git_url: https://git.bioconductor.org/packages/FLAMES
git_branch: devel
git_last_commit: 344299b
git_last_commit_date: 2026-04-08 02:59:15 -0400 (Wed, 08 Apr 2026)
nebbiolo1Linux (Ubuntu 24.04.4 LTS) / x86_64  OK    OK    WARNINGS  UNNEEDED, same version is already published
kjohnson3macOS 13.7.7 Ventura / arm64  OK    OK    WARNINGS    OK  UNNEEDED, same version is already published
See other builds for FLAMES in R Universe.


CHECK results for FLAMES on kjohnson3

To the developers/maintainers of the FLAMES package:
- Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/FLAMES.git to reflect on this report. See Troubleshooting Build Report for more information.
- Use the following Renviron settings to reproduce errors and warnings.
- If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information.

raw results


Summary

Package: FLAMES
Version: 2.5.3
Command: /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings FLAMES_2.5.3.tar.gz
StartedAt: 2026-04-10 20:07:22 -0400 (Fri, 10 Apr 2026)
EndedAt: 2026-04-10 20:16:51 -0400 (Fri, 10 Apr 2026)
EllapsedTime: 568.5 seconds
RetCode: 0
Status:   WARNINGS  
CheckDir: FLAMES.Rcheck
Warnings: 1

Command output

##############################################################################
##############################################################################
###
### Running command:
###
###   /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings FLAMES_2.5.3.tar.gz
###
##############################################################################
##############################################################################


* using log directory ‘/Users/biocbuild/bbs-3.23-bioc/meat/FLAMES.Rcheck’
* using R version 4.6.0 alpha (2026-04-08 r89818)
* using platform: aarch64-apple-darwin23
* R was compiled by
    Apple clang version 17.0.0 (clang-1700.3.19.1)
    GNU Fortran (GCC) 14.2.0
* running under: macOS Tahoe 26.3.1
* using session charset: UTF-8
* current time: 2026-04-11 00:07:23 UTC
* using option ‘--no-vignettes’
* checking for file ‘FLAMES/DESCRIPTION’ ... OK
* this is package ‘FLAMES’ version ‘2.5.3’
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... INFO
Imports includes 47 non-default packages.
Importing from so many packages makes the package vulnerable to any of
them becoming unavailable.  Move as many as possible to Suggests and
use conditionally.
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... NOTE
Found the following hidden files and directories:
  .dockerignore
These were most likely included in error. See section ‘Package
structure’ in the ‘Writing R Extensions’ manual.
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘FLAMES’ can be installed ... NOTE
Found the following notes/warnings:
  Non-staged installation was used
See ‘/Users/biocbuild/bbs-3.23-bioc/meat/FLAMES.Rcheck/00install.out’ for details.
* used C++ compiler: ‘Apple clang version 17.0.0 (clang-1700.6.4.2)’
* used SDK: ‘MacOSX26.2.sdk’
* checking C++ specification ... INFO
  specified C++17
* checking installed package size ... INFO
  installed size is 11.0Mb
  sub-directories of 1Mb or more:
    bin    5.9Mb
    data   1.8Mb
    libs   1.6Mb
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking code files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking dependencies in R code ... NOTE
There are ::: calls to the package's namespace in its code. A package
  almost never needs to use ::: for its own objects:
  'blaze' 'find_barcode' 'gene_quantification' 'isoform_identification'
  'minimap2_align' 'transcript_quantification'
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... NOTE
BulkPipeline: no visible global function definition for ‘new’
BulkPipeline: no visible global function definition for ‘setNames’
MultiSampleSCPipeline: no visible global function definition for ‘new’
MultiSampleSCPipeline: no visible global function definition for
  ‘setNames’
SingleCellPipeline: no visible global function definition for ‘new’
SingleCellPipeline: no visible global function definition for
  ‘setNames’
addRowRanges: no visible global function definition for ‘head’
addRowRanges: no visible global function definition for ‘as’
add_gene_counts: no visible global function definition for ‘as’
barcode_group: no visible global function definition for ‘new’
barcode_segment: no visible global function definition for ‘new’
cache_dir: no visible global function definition for ‘packageVersion’
chisq_test_by_gene: no visible global function definition for
  ‘chisq.test’
create_sce_from_dir: no visible global function definition for
  ‘setNames’
create_spe: no visible binding for global variable ‘barcode’
create_spe: no visible binding for global variable ‘in_tissue’
download_oarfish: no visible global function definition for
  ‘download.file’
download_oarfish: no visible global function definition for ‘unzip’
filter_coverage: no visible global function definition for
  ‘starts_with’
filter_coverage: no visible binding for global variable ‘filter_res’
find_diversity: no visible global function definition for ‘as’
find_variants: no visible global function definition for ‘setNames’
find_variants_grange: no visible binding for global variable
  ‘which_label’
find_variants_grange: no visible binding for global variable
  ‘nucleotide’
find_variants_grange: no visible binding for global variable ‘pos’
find_variants_grange: no visible binding for global variable ‘count’
find_variants_grange: no visible binding for global variable
  ‘counts_no_ins’
find_variants_grange: no visible binding for global variable ‘ref’
generate_sc_sce: no visible binding for global variable ‘FSM_match’
get_coverage: no visible binding for global variable ‘Freq’
homopolymer_pct : <anonymous>: no visible binding for global variable
  ‘Freq’
homopolymer_pct : <anonymous>: no visible binding for global variable
  ‘pct’
plot_coverage: no visible binding for global variable ‘tr_length’
plot_coverage: no visible binding for global variable ‘read_counts’
plot_coverage: no visible binding for global variable ‘total_counts’
plot_coverage: no visible binding for global variable ‘cumpct’
plot_coverage: no visible binding for global variable ‘length_bin’
plot_coverage: no visible binding for global variable ‘min_length’
plot_coverage: no visible binding for global variable ‘max_length’
plot_coverage: no visible global function definition for ‘head’
plot_coverage: no visible binding for global variable ‘transcript’
plot_demultiplex_raw: no visible binding for global variable ‘Sample’
plot_demultiplex_raw: no visible binding for global variable ‘CB’
plot_demultiplex_raw: no visible binding for global variable ‘UB’
plot_demultiplex_raw: no visible binding for global variable
  ‘UMI_count’
plot_demultiplex_raw: no visible binding for global variable
  ‘barcode_rank’
plot_demultiplex_raw: no visible binding for global variable
  ‘FlankEditDist’
plot_demultiplex_raw: no visible binding for global variable ‘n_reads’
plot_demultiplex_raw: no visible binding for global variable ‘total
  reads’
plot_demultiplex_raw: no visible binding for global variable
  ‘demultiplexed reads’
plot_demultiplex_raw: no visible binding for global variable ‘single
  match reads’
plot_demultiplex_raw: no visible binding for global variable
  ‘undemultiplexted reads’
plot_demultiplex_raw: no visible binding for global variable
  ‘multi-matching reads’
plot_demultiplex_raw: no visible binding for global variable ‘Type’
plot_demultiplex_raw: no visible binding for global variable ‘Reads’
plot_demultiplex_raw: no visible binding for global variable ‘input’
plot_demultiplex_raw: no visible binding for global variable ‘output’
plot_demultiplex_raw: no visible binding for global variable
  ‘read1_with_adapter’
plot_demultiplex_raw: no visible binding for global variable ‘Count’
plot_flagstat: no visible global function definition for ‘everything’
plot_flagstat: no visible binding for global variable ‘name’
plot_flagstat: no visible binding for global variable ‘value’
plot_isoform_reduced_dim: no visible binding for global variable ‘x’
plot_isoform_reduced_dim: no visible binding for global variable ‘y’
plot_isoform_reduced_dim: no visible binding for global variable ‘expr’
plot_spatial: no visible binding for global variable ‘imageX’
plot_spatial: no visible binding for global variable ‘imageY’
plot_spatial_feature: no visible binding for global variable ‘imageX’
plot_spatial_feature: no visible binding for global variable ‘imageY’
plot_spatial_feature: no visible binding for global variable ‘x’
plot_spatial_feature: no visible binding for global variable ‘y’
plot_spatial_feature: no visible global function definition for
  ‘scale_alpha_continuous’
plot_spatial_feature: no visible global function definition for
  ‘scale_colour_gradient’
plot_spatial_isoform: no visible global function definition for ‘head’
plot_spatial_pie: no visible global function definition for ‘setNames’
plot_spatial_pie: no visible global function definition for ‘head’
plot_spatial_pie: no visible binding for global variable ‘imageX’
plot_spatial_pie: no visible binding for global variable ‘imageY’
sc_genotype: no visible binding for global variable ‘allele’
sc_genotype: no visible binding for global variable ‘allele_count’
sc_genotype: no visible binding for global variable ‘barcode’
sc_genotype: no visible binding for global variable ‘pct’
sc_mutations: no visible binding for global variable ‘mutation_index’
sc_mutations: no visible binding for global variable ‘bam_index’
sc_plot_genotype: no visible global function definition for ‘setNames’
sc_plot_genotype: no visible binding for global variable ‘barcode’
sc_plot_genotype: no visible binding for global variable ‘genotype’
sc_plot_genotype: no visible binding for global variable ‘x’
sc_plot_genotype: no visible binding for global variable ‘y’
sc_transcript_usage_chisq: no visible global function definition for
  ‘as’
sc_transcript_usage_chisq: no visible binding for global variable
  ‘p.value’
sc_transcript_usage_chisq: no visible binding for global variable
  ‘adj.p.value’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘total’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘test’
sc_transcript_usage_permutation: no visible global function definition
  for ‘as’
sc_transcript_usage_permutation : <anonymous>: no visible global
  function definition for ‘as’
sc_transcript_usage_permutation : <anonymous> : <anonymous>: no visible
  global function definition for ‘na.omit’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘transcript’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘p.value’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘adj.p.value’
variant_count_tb: no visible binding for global variable ‘barcode’
variant_count_tb: no visible binding for global variable ‘allele_count’
variant_count_tb: no visible binding for global variable
  ‘cell_total_reads’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding
  for global variable ‘expect_cell_number’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding
  for global variable ‘fastq’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding
  for global variable ‘outdir’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding
  for global variable ‘demultiplexed_fastq’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding
  for global variable ‘barcodes_file’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible global
  function definition for ‘setNames’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline : <anonymous>: no
  visible global function definition for ‘setNames’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for
  global variable ‘expect_cell_number’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for
  global variable ‘fastq’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for
  global variable ‘outdir’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for
  global variable ‘demultiplexed_fastq’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for
  global variable ‘barcodes_files’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible global
  function definition for ‘setNames’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘j’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘genome_bam’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘minimap2’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘samtools’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘threads’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘outdir’
plot_durations,FLAMES.Pipeline: no visible binding for global variable
  ‘step’
plot_durations,FLAMES.Pipeline: no visible binding for global variable
  ‘duration’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘j’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘transcriptome_assembly’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘transcriptome_bam’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘minimap2’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘samtools’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘outdir’
resume_FLAMES,FLAMES.Pipeline : <anonymous>: no visible global function
  definition for ‘capture.output’
run_FLAMES,FLAMES.Pipeline : <anonymous>: no visible global function
  definition for ‘capture.output’
Undefined global functions or variables:
  CB Count FSM_match FlankEditDist Freq Reads Sample Type UB UMI_count
  adj.p.value allele allele_count as bam_index barcode barcode_rank
  barcodes_file barcodes_files capture.output cell_total_reads
  chisq.test count counts_no_ins cumpct demultiplexed reads
  demultiplexed_fastq download.file duration everything
  expect_cell_number expr fastq filter_res genome_bam genotype head
  imageX imageY in_tissue input j length_bin max_length min_length
  minimap2 multi-matching reads mutation_index n_reads na.omit name new
  nucleotide outdir output p.value packageVersion pct pos
  read1_with_adapter read_counts ref samtools scale_alpha_continuous
  scale_colour_gradient setNames single match reads starts_with step
  test threads total total reads total_counts tr_length transcript
  transcriptome_assembly transcriptome_bam undemultiplexted reads unzip
  value which_label x y
Consider adding
  importFrom("base", "match", "single")
  importFrom("methods", "as", "new")
  importFrom("stats", "chisq.test", "na.omit", "setNames", "step")
  importFrom("utils", "capture.output", "download.file", "head",
             "packageVersion", "unzip")
to your NAMESPACE file (and ensure that your DESCRIPTION Imports field
contains 'methods').
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking contents of ‘data’ directory ... OK
* checking data for non-ASCII characters ... OK
* checking data for ASCII and uncompressed saves ... OK
* checking line endings in shell scripts ... OK
* checking line endings in C/C++/Fortran sources/headers ... OK
* checking line endings in Makefiles ... OK
* checking compilation flags in Makevars ... OK
* checking for GNU extensions in Makefiles ... INFO
GNU make is a SystemRequirements.
* checking for portable use of $(BLAS_LIBS) and $(LAPACK_LIBS) ... OK
* checking use of PKG_*FLAGS in Makefiles ... OK
* checking include directives in Makefiles ... OK
* checking compiled code ... NOTE
Note: information on .o files is not available
File ‘/Library/Frameworks/R.framework/Versions/4.6/Resources/library/FLAMES/libs/FLAMES.so’:
  Found ‘___assert_rtn’, possibly from ‘assert’ (C)
  Found ‘___stderrp’, possibly from ‘stderr’ (C)
  Found ‘___stdoutp’, possibly from ‘stdout’ (C)
  Found ‘_abort’, possibly from ‘abort’ (C)
  Found ‘_exit’, possibly from ‘exit’ (C)

Compiled code should not call entry points which might terminate R nor
write to stdout/stderr instead of to the console, nor use Fortran I/O
nor system RNGs nor [v]sprintf. The detected symbols are linked into
the code but might come from libraries and not actually be called.

See ‘Writing portable packages’ in the ‘Writing R Extensions’ manual.
* checking files in ‘vignettes’ ... OK
* checking examples ... WARNING
Found the following significant warnings:

  Warning in .local(x, ...) : 'normalizeCounts' is deprecated.
  Warning in .local(x, ...) : 'normalizeCounts' is deprecated.
  Warning in .local(x, ...) : 'normalizeCounts' is deprecated.
  Warning in .local(x, ...) : 'librarySizeFactors' is deprecated.
  Warning in .local(x, ...) : 'normalizeCounts' is deprecated.
  Warning in .local(x, ...) : 'librarySizeFactors' is deprecated.
  Warning in .local(x, ...) : 'normalizeCounts' is deprecated.
  Warning in .local(x, ...) : 'normalizeCounts' is deprecated.
  Warning in .local(x, ...) : 'librarySizeFactors' is deprecated.
  Warning in .local(x, ...) : 'normalizeCounts' is deprecated.
Deprecated functions may be defunct as soon as of the next release of
R.
See ?Deprecated.
Examples with CPU (user + system) or elapsed time > 5s
                              user system elapsed
plot_isoform_reduced_dim     9.938  0.068  10.044
sc_long_multisample_pipeline 5.833  1.206   5.136
find_variants                6.631  0.391   6.568
sc_plot_genotype             5.186  0.147   4.711
MultiSampleSCPipeline        4.352  0.622   5.380
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
  Running ‘testthat.R’
 OK
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes ... OK
* checking running R code from vignettes ... SKIPPED
* checking re-building of vignette outputs ... SKIPPED
* checking PDF version of manual ... OK
* DONE

Status: 1 WARNING, 5 NOTEs
See
  ‘/Users/biocbuild/bbs-3.23-bioc/meat/FLAMES.Rcheck/00check.log’
for details.


Installation output

FLAMES.Rcheck/00install.out

##############################################################################
##############################################################################
###
### Running command:
###
###   /Library/Frameworks/R.framework/Resources/bin/R CMD INSTALL FLAMES
###
##############################################################################
##############################################################################


* installing to library ‘/Library/Frameworks/R.framework/Versions/4.6/Resources/library’
* installing *source* package ‘FLAMES’ ...
** this is package ‘FLAMES’ version ‘2.5.3’
** using non-staged installation via StagedInstall field
** libs
specified C++17
using C++ compiler: ‘Apple clang version 17.0.0 (clang-1700.6.4.2)’
using C++17
using SDK: ‘MacOSX26.2.sdk’
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c RcppExports.cpp -o RcppExports.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c RcppFunctions.cpp -o RcppFunctions.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c classes/BamRecord.cpp -o classes/BamRecord.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c classes/GFFRecord.cpp -o classes/GFFRecord.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c classes/GeneAnnotationParser.cpp -o classes/GeneAnnotationParser.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c classes/Isoforms.cpp -o classes/Isoforms.o
classes/Isoforms.cpp:725:22: warning: comparisons like 'X<=Y<=Z' don't have their mathematical meaning [-Wparentheses]
  725 |                                 } else if (0 < i < raw_iso_key.size() - 1) { // a site from the middle somewhere
      |                                                  ^
1 warning generated.
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c classes/junctions.cpp -o classes/junctions.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c main-functions/find_isoform.cpp -o main-functions/find_isoform.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c main-functions/flexiplex.cpp -o main-functions/flexiplex.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c main-functions/get_transcript_seq.cpp -o main-functions/get_transcript_seq.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c main-functions/group_bam2isoform.cpp -o main-functions/group_bam2isoform.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c main-functions/pileup_readid.cpp -o main-functions/pileup_readid.o
main-functions/pileup_readid.cpp:86:16: warning: unused variable 'end' [-Wunused-variable]
   86 |   unsigned int end;
      |                ^~~
1 warning generated.
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c tests/test-junctions.cpp -o tests/test-junctions.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c tests/test-parsing.cpp -o tests/test-parsing.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c utility/cigars.cpp -o utility/cigars.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c utility/edlib-1.2.7/edlib.cpp -o utility/edlib-1.2.7/edlib.o
clang -arch arm64 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.6/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2  -c utility/bam.c -o utility/bam.o
clang++ -arch arm64 -std=gnu++17 -dynamiclib -Wl,-headerpad_max_install_names -undefined dynamic_lookup -L/Library/Frameworks/R.framework/Resources/lib -L/opt/R/arm64/lib -o FLAMES.so RcppExports.o RcppFunctions.o classes/BamRecord.o classes/GFFRecord.o classes/GeneAnnotationParser.o classes/Isoforms.o classes/junctions.o main-functions/find_isoform.o main-functions/flexiplex.o main-functions/get_transcript_seq.o main-functions/group_bam2isoform.o main-functions/pileup_readid.o tests/test-junctions.o tests/test-parsing.o utility/cigars.o utility/edlib-1.2.7/edlib.o utility/bam.o -pthread -lz /Library/Frameworks/R.framework/Versions/4.6/Resources/library/Rhtslib/usrlib/libhts.a -lcurl -lbz2 -llzma -lz -F/Library/Frameworks/R.framework/.. -framework R
ld: warning: ignoring duplicate libraries: '-lz'
if test -e "/usr/bin/strip" & test -e "/bin/uname" & [[ `uname` == "Linux" ]] ; then /usr/bin/strip --strip-debug FLAMES.so; fi
Building for ARM64
(cd submodule/minimap2 && make -f Makefile CFLAGS="-falign-functions=64 -Wall -g -O2  -Wno-unused-result" arm_neon=1 aarch64=1 minimap2)
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  -Isse2neon main.c -o main.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  -Isse2neon kthread.c -o kthread.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  -Isse2neon kalloc.c -o kalloc.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  -Isse2neon misc.c -o misc.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  -Isse2neon bseq.c -o bseq.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  -Isse2neon sketch.c -o sketch.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  -Isse2neon sdust.c -o sdust.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  -Isse2neon options.c -o options.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  -Isse2neon index.c -o index.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  -Isse2neon lchain.c -o lchain.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  -Isse2neon align.c -o align.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  -Isse2neon hit.c -o hit.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  -Isse2neon seed.c -o seed.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  -Isse2neon jump.c -o jump.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  -Isse2neon map.c -o map.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  -Isse2neon format.c -o format.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  -Isse2neon pe.c -o pe.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  -Isse2neon esterr.c -o esterr.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  -Isse2neon splitidx.c -o splitidx.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  -Isse2neon ksw2_ll_sse.c -o ksw2_ll_sse.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC -DKSW_SSE2_ONLY -D__SSE2__  -Isse2neon ksw2_extz2_sse.c -o ksw2_extz2_neon.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC -DKSW_SSE2_ONLY -D__SSE2__  -Isse2neon ksw2_extd2_sse.c -o ksw2_extd2_neon.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC -DKSW_SSE2_ONLY -D__SSE2__  -Isse2neon ksw2_exts2_sse.c -o ksw2_exts2_neon.o
ar -csru libminimap2.a kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o lchain.o align.o hit.o seed.o jump.o map.o format.o pe.o esterr.o splitidx.o ksw2_ll_sse.o ksw2_extz2_neon.o ksw2_extd2_neon.o ksw2_exts2_neon.o
cc -falign-functions=64 -Wall -g -O2  -Wno-unused-result main.o -o minimap2 -L. -lminimap2 -lm -lz -lpthread
echo "Installing binary to /Users/biocbuild/bbs-3.23-bioc/meat/FLAMES/src/../inst/bin"
Installing binary to /Users/biocbuild/bbs-3.23-bioc/meat/FLAMES/src/../inst/bin
mkdir -p ../inst/bin
cp submodule/minimap2/minimap2 ../inst/bin/
Building oarfish with cargo
mkdir -p ../inst/bin
mkdir cargo_temp
(cargo install oarfish --root cargo_temp --bin oarfish --vers 0.8.0)
    Updating crates.io index
  Installing oarfish v0.8.0
    Updating crates.io index
     Locking 278 packages to latest compatible versions
      Adding generic-array v0.14.7 (available: v0.14.9)
      Adding indicatif v0.17.11 (available: v0.18.4)
      Adding needletail v0.6.3 (available: v0.7.2)
      Adding noodles-bam v0.78.0 (available: v0.85.0)
      Adding noodles-bgzf v0.38.0 (available: v0.45.0)
      Adding noodles-sam v0.74.0 (available: v0.81.0)
      Adding rand v0.9.2 (available: v0.10.0)
      Adding tabled v0.18.0 (available: v0.20.0)
      Adding typed-builder v0.21.2 (available: v0.23.2)
      Adding wasip2 v1.0.2+wasi-0.2.9 (requires Rust 1.87.0)
      Adding wasip3 v0.4.0+wasi-0.3.0-rc-2026-01-06 (requires Rust 1.87.0)
      Adding wit-bindgen v0.51.0 (requires Rust 1.87.0)
      Adding wit-bindgen-core v0.51.0 (requires Rust 1.87.0)
      Adding wit-bindgen-rust v0.51.0 (requires Rust 1.87.0)
 Downloading crates ...
  Downloaded cc v1.2.60
   Compiling libc v0.2.184
   Compiling proc-macro2 v1.0.106
   Compiling unicode-ident v1.0.24
   Compiling quote v1.0.45
   Compiling find-msvc-tools v0.1.9
   Compiling shlex v1.3.0
   Compiling cfg-if v1.0.4
   Compiling autocfg v1.5.0
   Compiling pkg-config v0.3.32
   Compiling libm v0.2.16
   Compiling memchr v2.8.0
   Compiling zerocopy v0.8.48
   Compiling crossbeam-utils v0.8.21
   Compiling version_check v0.9.5
   Compiling simd-adler32 v0.3.9
   Compiling crc32fast v1.5.0
   Compiling once_cell v1.21.4
   Compiling adler2 v2.0.1
   Compiling regex-syntax v0.8.10
   Compiling serde_core v1.0.228
   Compiling zlib-rs v0.6.3
   Compiling typenum v1.19.0
   Compiling pin-project-lite v0.2.17
   Compiling rawpointer v0.2.1
   Compiling futures-core v0.3.32
   Compiling either v1.15.0
   Compiling hashbrown v0.17.0
   Compiling miniz_oxide v0.8.9
   Compiling equivalent v1.0.2
   Compiling getrandom v0.3.4
   Compiling lexical-util v1.0.7
   Compiling serde v1.0.228
   Compiling futures-sink v0.3.32
   Compiling paste v1.0.15
   Compiling generic-array v0.14.7
   Compiling futures-channel v0.3.32
   Compiling futures-task v0.3.32
   Compiling num-traits v0.2.19
   Compiling matrixmultiply v0.3.10
   Compiling aho-corasick v1.1.4
   Compiling vcpkg v0.2.15
   Compiling indexmap v2.14.0
   Compiling futures-io v0.3.32
   Compiling slab v0.4.12
   Compiling zstd-safe v7.2.4
   Compiling heck v0.5.0
   Compiling bytecount v0.6.9
   Compiling zstd-safe v6.0.6
   Compiling bitflags v2.11.0
   Compiling lexical-parse-integer v1.0.6
   Compiling lexical-write-integer v1.0.6
   Compiling num-complex v0.2.4
   Compiling ahash v0.8.12
   Compiling tracing-core v0.1.36
   Compiling rayon-core v1.13.0
   Compiling lazy_static v1.5.0
   Compiling zmij v1.0.21
   Compiling rustversion v1.0.22
   Compiling rustix v1.1.4
   Compiling itoa v1.0.18
   Compiling snap v1.1.1
   Compiling unicode-width v0.2.2
   Compiling byteorder v1.5.0
   Compiling getrandom v0.4.2
   Compiling crossbeam-epoch v0.9.18
   Compiling crossbeam-channel v0.5.15
   Compiling anyhow v1.0.102
   Compiling utf8parse v0.2.2
   Compiling crossbeam-deque v0.8.6
   Compiling semver v1.0.28
   Compiling bytes v1.11.1
   Compiling anstyle-parse v1.0.0
   Compiling rustc_version v0.4.1
   Compiling regex-automata v0.4.14
   Compiling syn v2.0.117
   Compiling proc-macro-error-attr2 v2.0.0
   Compiling getrandom v0.2.17
   Compiling errno v0.3.14
   Compiling rand_core v0.6.4
   Compiling jobserver v0.1.34
   Compiling lexical-write-float v1.0.6
   Compiling lexical-parse-float v1.0.6
   Compiling buffer-redux v1.1.0
   Compiling cc v1.2.60
   Compiling fallible-streaming-iterator v0.1.9
   Compiling static_assertions v1.1.0
   Compiling portable-atomic v1.13.1
   Compiling log v0.4.29
   Compiling is_terminal_polyfill v1.70.2
   Compiling anstyle v1.0.14
   Compiling array-init-cursor v0.2.1
   Compiling flate2 v1.1.9
   Compiling smallvec v1.15.1
   Compiling thiserror v1.0.69
   Compiling crypto-common v0.1.7
   Compiling block-buffer v0.10.4
   Compiling bit-vec v0.8.0
   Compiling noodles-bgzf v0.38.0
   Compiling colorchoice v1.0.5
   Compiling serde_json v1.0.149
   Compiling anstyle-query v1.1.5
   Compiling anstream v1.0.0
   Compiling digest v0.10.7
   Compiling planus v0.3.1
   Compiling tracing-log v0.2.0
   Compiling streaming-decompression v0.1.2
   Compiling lexical-core v1.0.6
   Compiling twox-hash v1.6.3
   Compiling num-integer v0.1.46
   Compiling num-complex v0.4.6
   Compiling approx v0.5.1
   Compiling approx v0.3.2
   Compiling noisy_float v0.2.1
   Compiling rand_core v0.9.5
   Compiling cpufeatures v0.2.17
   Compiling arrow2 v0.18.0
   Compiling num-bigint v0.4.6
   Compiling num-iter v0.1.45
   Compiling sharded-slab v0.1.7
   Compiling zstd-sys v2.0.16+zstd.1.5.7
   Compiling liblzma-sys v0.3.13
   Compiling bzip2-sys v0.1.13+1.0.8
   Compiling libz-sys v1.1.28
   Compiling sha2-asm v0.6.4
   Compiling minimap2-sys v0.1.30+minimap2.2.30
   Compiling lz4-sys v1.11.1+lz4-1.10.0
   Compiling ndarray v0.16.1
   Compiling itertools v0.13.0
   Compiling thread_local v1.1.9
   Compiling fastrand v2.4.1
   Compiling fnv v1.0.7
   Compiling nu-ansi-term v0.50.3
   Compiling clap_lex v1.1.0
   Compiling seq-macro v0.3.6
   Compiling strsim v0.11.1
   Compiling papergrid v0.14.0
   Compiling ndarray v0.15.6
   Compiling clap_builder v4.6.0
   Compiling bstr v1.12.1
   Compiling matchers v0.2.0
   Compiling rayon v1.11.0
   Compiling regex v1.12.3
   Compiling num-rational v0.4.2
   Compiling noodles-core v0.17.0
   Compiling proc-macro-error2 v2.0.1
   Compiling noodles-csi v0.46.0
   Compiling num v0.4.3
   Compiling alga v0.9.3
   Compiling tempfile v3.27.0
   Compiling ndarray v0.17.2
   Compiling lz4_flex v0.10.0
   Compiling bzip2 v0.4.4
   Compiling chrono v0.4.44
   Compiling num_cpus v1.17.0
   Compiling console v0.15.11
   Compiling crossbeam-queue v0.3.12
   Compiling noodles-sam v0.74.0
   Compiling csv-core v0.1.13
   Compiling itertools v0.14.0
   Compiling foreign_vec v0.1.0
   Compiling base64 v0.21.7
   Compiling sha2 v0.10.9
   Compiling hash_hasher v2.0.4
   Compiling ryu v1.0.23
   Compiling arrayvec v0.7.6
   Compiling number_prefix v0.4.0
   Compiling base64 v0.22.1
   Compiling liblzma v0.3.6
   Compiling streaming-iterator v0.1.9
   Compiling dyn-clone v1.0.20
   Compiling simdutf8 v0.1.5
   Compiling hex v0.4.3
   Compiling ethnum v1.5.2
   Compiling indicatif v0.17.11
   Compiling num-format v0.4.4
   Compiling csv v1.4.0
   Compiling bytemuck_derive v1.10.2
   Compiling futures-macro v0.3.32
   Compiling serde_derive v1.0.228
   Compiling ppv-lite86 v0.2.21
   Compiling async-trait v0.1.89
   Compiling async-stream-impl v0.3.6
   Compiling tracing-attributes v0.1.31
   Compiling rand_chacha v0.3.1
   Compiling futures-util v0.3.32
   Compiling thiserror-impl v1.0.69
   Compiling rand v0.8.5
   Compiling hashbrown v0.14.5
   Compiling rand_chacha v0.9.0
   Compiling async-stream v0.3.6
   Compiling tabled_derive v0.10.0
   Compiling derive-new v0.6.0
   Compiling typed-builder-macro v0.21.2
   Compiling clap_derive v4.6.0
   Compiling strum_macros v0.26.4
   Compiling rand v0.9.2
   Compiling noodles-bam v0.78.0
   Compiling crossbeam v0.8.4
   Compiling rustc-hash v2.1.2
   Compiling bytemuck v1.25.0
   Compiling atomic_float v1.1.0
   Compiling path-tools v0.1.0
   Compiling parse-size v1.1.0
   Compiling tracing v0.1.44
   Compiling rand_distr v0.4.3
   Compiling safe_arch v0.7.4
   Compiling tabled v0.18.0
   Compiling wide v0.7.33
   Compiling tracing-subscriber v0.3.23
   Compiling typed-builder v0.21.2
   Compiling futures-executor v0.3.32
   Compiling futures v0.3.32
   Compiling parquet-format-safe v0.2.4
   Compiling clap v4.6.0
   Compiling bincode v1.3.3
   Compiling arrow-format v0.8.1
   Compiling bio-types v1.0.4
   Compiling simba v0.9.1
   Compiling sendable-swapvec v0.4.3
   Compiling lz4 v1.28.1
   Compiling ndarray-stats v0.6.0
   Compiling kders v0.1.1
   Compiling zstd v0.12.4
   Compiling parquet2 v0.17.2
   Compiling zstd v0.13.3
   Compiling needletail v0.6.3
   Compiling sprs v0.11.4
   Compiling nalgebra v0.33.3
   Compiling seqcol_rs v0.4.1
   Compiling minimap2 v0.1.31+minimap2.2.30
   Compiling statrs v0.18.0
   Compiling oarfish v0.8.0
    Finished `release` profile [optimized] target(s) in 33.39s
  Installing cargo_temp/bin/oarfish
   Installed package `oarfish v0.8.0` (executable `oarfish`)
warning: be sure to add `cargo_temp/bin` to your PATH to be able to run the installed binaries
cp cargo_temp/bin/oarfish ../inst/bin/
cargo uninstall oarfish --root cargo_temp
    Removing cargo_temp/bin/oarfish
rm -rf cargo_temp
installing to /Library/Frameworks/R.framework/Versions/4.6/Resources/library/FLAMES/libs
** R
** data
** inst
** byte-compile and prepare package for lazy loading
** help
*** installing help indices
*** copying figures
** building package indices
** installing vignettes
** testing if installed package can be loaded
* DONE (FLAMES)

Tests output

FLAMES.Rcheck/tests/testthat.Rout


R version 4.6.0 alpha (2026-04-08 r89818)
Copyright (C) 2026 The R Foundation for Statistical Computing
Platform: aarch64-apple-darwin23

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> # This file is part of the standard setup for testthat.
> # It is recommended that you do not modify it.
> #
> # Where should you do additional test configuration?
> # Learn more about the roles of various files in:
> # * https://r-pkgs.org/tests.html
> # * https://testthat.r-lib.org/reference/test_package.html#special-files
> 
> library(testthat)
> library(FLAMES)
> 
> test_check("FLAMES")
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4753487fc/config_file_39892.json 
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4753487fc/config_file_39892.json 
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4753487fc/config_file_39892.json 
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4e169820/config_file_39892.json 
Converting legacy `pattern` argument to `segments`...
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd47fe475e9/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /Library/Frameworks/R.framework/Versions/4.6/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
Skipping TSO trimming...
Converting legacy `pattern` argument to `segments`...
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd43b260d97/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /Library/Frameworks/R.framework/Versions/4.6/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
Skipping TSO trimming...
Converting legacy `pattern` argument to `segments`...
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd43b260d97/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd421e8c1b5/musc_rps24_1.fastq
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd421e8c1b5/musc_rps24_2.fastq
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd421e8c1b5/musc_rps24_3.fastq
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd421e8c1b5/musc_rps24_4.fastq
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
Skipping TSO trimming...
Converting legacy `pattern` argument to `segments`...
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd41ab8f57b/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /Library/Frameworks/R.framework/Versions/4.6/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
Skipping TSO trimming...
Testing: run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd468583b96/config_file_39892.json 
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Fri Apr 10 20:11:11 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample sample1 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd468583b96/sample1_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample2 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd468583b96/sample2_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample3 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd468583b96/sample3_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: isoform_identification @ Fri Apr 10 20:11:12 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |=======================                                               |  33%
  |                                                                            
  |===============================================                       |  67%
  |                                                                            
  |======================================================================| 100%

Detected 6 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Fri Apr 10 20:11:22 2026 -------------------
Realigning sample sample1 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd468583b96/sample1_realign2transcript.bam
Skipped sorting BAM files.

Realigning sample sample2 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd468583b96/sample2_realign2transcript.bam
Skipped sorting BAM files.

Realigning sample sample3 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd468583b96/sample3_realign2transcript.bam
Skipped sorting BAM files.

-- Running step: transcript_quantification @ Fri Apr 10 20:11:23 2026 ----------
2026-04-11T00:11:23.158164Z  INFO oarfish: setting user-provided filter parameters.
2026-04-11T00:11:23.158391Z  INFO oarfish::alignment_parser: read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd468583b96/sample1_realign2transcript.bam, contains 5 reference sequences.
2026-04-11T00:11:23.158422Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-11T00:11:23.158428Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-11T00:11:23.158485Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-11T00:11:23.158502Z  INFO oarfish: parsed reference information for 5 transcripts.
2026-04-11T00:11:23.161007Z  INFO oarfish::alignment_parser: the alignment file contained 2 unmapped read records.
2026-04-11T00:11:23.161084Z  INFO oarfish::bulk: 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 697   │
│ aligned fraction too low        │ 13    │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 5     │
│ reads with valid best alignment │ 285   │
╰─────────────────────────────────┴───────╯

2026-04-11T00:11:23.161107Z  INFO oarfish::bulk: Total number of alignment records : 366
2026-04-11T00:11:23.161112Z  INFO oarfish::bulk: number of aligned reads : 285
2026-04-11T00:11:23.161115Z  INFO oarfish::bulk: number of unique alignments : 238
2026-04-11T00:11:23.162603Z  INFO oarfish: oarfish completed successfully.
2026-04-11T00:11:23.177845Z  INFO oarfish: setting user-provided filter parameters.
2026-04-11T00:11:23.178016Z  INFO oarfish::alignment_parser: read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd468583b96/sample2_realign2transcript.bam, contains 5 reference sequences.
2026-04-11T00:11:23.178029Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-11T00:11:23.178033Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-11T00:11:23.178079Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-11T00:11:23.178085Z  INFO oarfish: parsed reference information for 5 transcripts.
2026-04-11T00:11:23.180754Z  INFO oarfish::alignment_parser: the alignment file contained 1 unmapped read records.
2026-04-11T00:11:23.180825Z  INFO oarfish::bulk: 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 701   │
│ aligned fraction too low        │ 11    │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 6     │
│ reads with valid best alignment │ 288   │
╰─────────────────────────────────┴───────╯

2026-04-11T00:11:23.180857Z  INFO oarfish::bulk: Total number of alignment records : 362
2026-04-11T00:11:23.180861Z  INFO oarfish::bulk: number of aligned reads : 288
2026-04-11T00:11:23.180864Z  INFO oarfish::bulk: number of unique alignments : 244
2026-04-11T00:11:23.182189Z  INFO oarfish: oarfish completed successfully.
2026-04-11T00:11:23.198410Z  INFO oarfish: setting user-provided filter parameters.
2026-04-11T00:11:23.198607Z  INFO oarfish::alignment_parser: read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd468583b96/sample3_realign2transcript.bam, contains 5 reference sequences.
2026-04-11T00:11:23.198623Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-11T00:11:23.198627Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-11T00:11:23.198668Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-11T00:11:23.198676Z  INFO oarfish: parsed reference information for 5 transcripts.
2026-04-11T00:11:23.201083Z  INFO oarfish::alignment_parser: the alignment file contained 1 unmapped read records.
2026-04-11T00:11:23.201156Z  INFO oarfish::bulk: 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 698   │
│ aligned fraction too low        │ 12    │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 6     │
│ reads with valid best alignment │ 287   │
╰─────────────────────────────────┴───────╯

2026-04-11T00:11:23.201177Z  INFO oarfish::bulk: Total number of alignment records : 363
2026-04-11T00:11:23.201182Z  INFO oarfish::bulk: number of aligned reads : 287
2026-04-11T00:11:23.201185Z  INFO oarfish::bulk: number of unique alignments : 243
2026-04-11T00:11:23.202542Z  INFO oarfish: oarfish completed successfully.
Testing: run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4298436f7/config_file_39892.json 
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Fri Apr 10 20:11:23 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
sample1 ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4298436f7/sample1_align2genome.bam
sample2 ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4298436f7/sample2_align2genome.bam
sample3 ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4298436f7/sample3_align2genome.bam
-- Running step: isoform_identification @ Fri Apr 10 20:11:32 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |=======================                                               |  33%
  |                                                                            
  |===============================================                       |  67%
  |                                                                            
  |======================================================================| 100%

Detected 4 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Fri Apr 10 20:11:39 2026 -------------------
Realignment complete for the following samples:
sample1 ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4298436f7/sample1_realign2transcript.bam
sample2 ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4298436f7/sample2_realign2transcript.bam
sample3 ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4298436f7/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Fri Apr 10 20:11:48 2026 ----------
2026-04-11T00:11:48.669492Z  INFO oarfish: setting user-provided filter parameters.
2026-04-11T00:11:48.669716Z  INFO oarfish::alignment_parser: read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4298436f7/sample1_realign2transcript.bam, contains 5 reference sequences.
2026-04-11T00:11:48.669732Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-11T00:11:48.669737Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-11T00:11:48.669777Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-11T00:11:48.669785Z  INFO oarfish: parsed reference information for 5 transcripts.
2026-04-11T00:11:48.672413Z  INFO oarfish::alignment_parser: the alignment file contained 2 unmapped read records.
2026-04-11T00:11:48.672497Z  INFO oarfish::bulk: 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 690   │
│ aligned fraction too low        │ 17    │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 4     │
│ reads with valid best alignment │ 281   │
╰─────────────────────────────────┴───────╯

2026-04-11T00:11:48.672534Z  INFO oarfish::bulk: Total number of alignment records : 357
2026-04-11T00:11:48.672540Z  INFO oarfish::bulk: number of aligned reads : 281
2026-04-11T00:11:48.672544Z  INFO oarfish::bulk: number of unique alignments : 236
2026-04-11T00:11:48.673896Z  INFO oarfish: oarfish completed successfully.
2026-04-11T00:11:48.692702Z  INFO oarfish: setting user-provided filter parameters.
2026-04-11T00:11:48.692983Z  INFO oarfish::alignment_parser: read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4298436f7/sample2_realign2transcript.bam, contains 5 reference sequences.
2026-04-11T00:11:48.693009Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-11T00:11:48.693015Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-11T00:11:48.693123Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-11T00:11:48.693136Z  INFO oarfish: parsed reference information for 5 transcripts.
2026-04-11T00:11:48.695611Z  INFO oarfish::alignment_parser: the alignment file contained 2 unmapped read records.
2026-04-11T00:11:48.695686Z  INFO oarfish::bulk: 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 699   │
│ aligned fraction too low        │ 16    │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 6     │
│ reads with valid best alignment │ 282   │
╰─────────────────────────────────┴───────╯

2026-04-11T00:11:48.695707Z  INFO oarfish::bulk: Total number of alignment records : 354
2026-04-11T00:11:48.695711Z  INFO oarfish::bulk: number of aligned reads : 282
2026-04-11T00:11:48.695714Z  INFO oarfish::bulk: number of unique alignments : 239
2026-04-11T00:11:48.697393Z  INFO oarfish: oarfish completed successfully.
2026-04-11T00:11:48.716043Z  INFO oarfish: setting user-provided filter parameters.
2026-04-11T00:11:48.716263Z  INFO oarfish::alignment_parser: read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4298436f7/sample3_realign2transcript.bam, contains 5 reference sequences.
2026-04-11T00:11:48.716279Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-11T00:11:48.716284Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-11T00:11:48.716357Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-11T00:11:48.716414Z  INFO oarfish: parsed reference information for 5 transcripts.
2026-04-11T00:11:48.718769Z  INFO oarfish::alignment_parser: the alignment file contained 0 unmapped read records.
2026-04-11T00:11:48.718857Z  INFO oarfish::bulk: 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 695   │
│ aligned fraction too low        │ 17    │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 7     │
│ reads with valid best alignment │ 283   │
╰─────────────────────────────────┴───────╯

2026-04-11T00:11:48.718879Z  INFO oarfish::bulk: Total number of alignment records : 363
2026-04-11T00:11:48.718885Z  INFO oarfish::bulk: number of aligned reads : 283
2026-04-11T00:11:48.718889Z  INFO oarfish::bulk: number of unique alignments : 234
2026-04-11T00:11:48.720296Z  INFO oarfish: oarfish completed successfully.
Testing: run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd460661aac/config_file_39892.json 
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Fri Apr 10 20:11:48 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample sample1 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd460661aac/sample1_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample2 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd460661aac/sample2_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample3 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd460661aac/sample3_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: isoform_identification @ Fri Apr 10 20:11:49 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |=======================                                               |  33%
  |                                                                            
  |===============================================                       |  67%
  |                                                                            
  |======================================================================| 100%

Detected 4 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Fri Apr 10 20:11:56 2026 -------------------
Realigning sample sample1 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd460661aac/sample1_realign2transcript.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample sample2 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd460661aac/sample2_realign2transcript.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample sample3 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd460661aac/sample3_realign2transcript.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: transcript_quantification @ Fri Apr 10 20:11:56 2026 ----------
20:11:56 Fri Apr 10 2026 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
Testing: run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd433b46c02/config_file_39892.json 
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Fri Apr 10 20:11:58 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
sample1 ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd433b46c02/sample1_align2genome.bam
sample2 ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd433b46c02/sample2_align2genome.bam
sample3 ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd433b46c02/sample3_align2genome.bam
-- Running step: isoform_identification @ Fri Apr 10 20:12:08 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |=======================                                               |  33%
  |                                                                            
  |===============================================                       |  67%
  |                                                                            
  |======================================================================| 100%

Detected 6 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Fri Apr 10 20:12:14 2026 -------------------
Realignment complete for the following samples:
sample1 ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd433b46c02/sample1_realign2transcript.bam
sample2 ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd433b46c02/sample2_realign2transcript.bam
sample3 ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd433b46c02/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Fri Apr 10 20:12:23 2026 ----------
20:12:23 Fri Apr 10 2026 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
Inputs:  ['/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd460661aac/sample3_realign2transcript.bam', '/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd460661aac/sample2_realign2transcript.bam', '/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd460661aac/sample1_realign2transcript.bam'] /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd460661aac/transcript_assembly.fa.fai 5 0.4 0.4
	Counter({'counted_reads': 856, 'not_enough_coverage': 39, 'unmapped': 5})
Inputs:  ['/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd433b46c02/sample3_realign2transcript.bam', '/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd433b46c02/sample2_realign2transcript.bam', '/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd433b46c02/sample1_realign2transcript.bam'] /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd433b46c02/transcript_assembly.fa.fai 5 0.4 0.4
Testing: run_FLAMES(BulkPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd431f4371e/config_file_39892.json 
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Fri Apr 10 20:12:23 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample sample1 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd431f4371e/sample1_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample2 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd431f4371e/sample2_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample3 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd431f4371e/sample3_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: isoform_identification @ Fri Apr 10 20:12:24 2026 -------------
	Counter({'counted_reads': 859, 'not_enough_coverage': 37, 'unmapped': 4})
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Fri Apr 10 20:12:24 2026 -------------------
Realigning sample sample1 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd431f4371e/sample1_realign2transcript.bam
Skipped sorting BAM files.

Realigning sample sample2 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd431f4371e/sample2_realign2transcript.bam
Skipped sorting BAM files.

Realigning sample sample3 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd431f4371e/sample3_realign2transcript.bam
Skipped sorting BAM files.

-- Running step: transcript_quantification @ Fri Apr 10 20:12:25 2026 ----------
2026-04-11T00:12:25.712502Z  INFO oarfish: setting user-provided filter parameters.
2026-04-11T00:12:25.712857Z  INFO oarfish::alignment_parser: read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd431f4371e/sample1_realign2transcript.bam, contains 18 reference sequences.
2026-04-11T00:12:25.712873Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-11T00:12:25.712878Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-11T00:12:25.712944Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-11T00:12:25.712957Z  INFO oarfish: parsed reference information for 18 transcripts.
2026-04-11T00:12:25.718812Z  INFO oarfish::alignment_parser: the alignment file contained 0 unmapped read records.
2026-04-11T00:12:25.718921Z  INFO oarfish::bulk: 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 3593  │
│ aligned fraction too low        │ 5     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 0     │
│ reads with valid best alignment │ 295   │
╰─────────────────────────────────┴───────╯

2026-04-11T00:12:25.718947Z  INFO oarfish::bulk: Total number of alignment records : 492
2026-04-11T00:12:25.718953Z  INFO oarfish::bulk: number of aligned reads : 295
2026-04-11T00:12:25.718956Z  INFO oarfish::bulk: number of unique alignments : 198
2026-04-11T00:12:25.720619Z  INFO oarfish: oarfish completed successfully.
2026-04-11T00:12:25.738463Z  INFO oarfish: setting user-provided filter parameters.
2026-04-11T00:12:25.738721Z  INFO oarfish::alignment_parser: read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd431f4371e/sample2_realign2transcript.bam, contains 18 reference sequences.
2026-04-11T00:12:25.738747Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-11T00:12:25.738752Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-11T00:12:25.738824Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-11T00:12:25.738836Z  INFO oarfish: parsed reference information for 18 transcripts.
2026-04-11T00:12:25.744747Z  INFO oarfish::alignment_parser: the alignment file contained 0 unmapped read records.
2026-04-11T00:12:25.744835Z  INFO oarfish::bulk: 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 3550  │
│ aligned fraction too low        │ 10    │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 0     │
│ reads with valid best alignment │ 290   │
╰─────────────────────────────────┴───────╯

2026-04-11T00:12:25.744859Z  INFO oarfish::bulk: Total number of alignment records : 505
2026-04-11T00:12:25.744864Z  INFO oarfish::bulk: number of aligned reads : 290
2026-04-11T00:12:25.744867Z  INFO oarfish::bulk: number of unique alignments : 192
2026-04-11T00:12:25.746473Z  INFO oarfish: oarfish completed successfully.
2026-04-11T00:12:25.764425Z  INFO oarfish: setting user-provided filter parameters.
2026-04-11T00:12:25.764684Z  INFO oarfish::alignment_parser: read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd431f4371e/sample3_realign2transcript.bam, contains 18 reference sequences.
2026-04-11T00:12:25.764723Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-11T00:12:25.764730Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-11T00:12:25.764807Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-11T00:12:25.764822Z  INFO oarfish: parsed reference information for 18 transcripts.
2026-04-11T00:12:25.770795Z  INFO oarfish::alignment_parser: the alignment file contained 0 unmapped read records.
2026-04-11T00:12:25.770885Z  INFO oarfish::bulk: 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 3591  │
│ aligned fraction too low        │ 9     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 0     │
│ reads with valid best alignment │ 291   │
╰─────────────────────────────────┴───────╯

2026-04-11T00:12:25.770909Z  INFO oarfish::bulk: Total number of alignment records : 481
2026-04-11T00:12:25.770913Z  INFO oarfish::bulk: number of aligned reads : 291
2026-04-11T00:12:25.770916Z  INFO oarfish::bulk: number of unique alignments : 197
2026-04-11T00:12:25.772661Z  INFO oarfish: oarfish completed successfully.
Testing: run_FLAMES(BulkPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4b01e1c0/config_file_39892.json 
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Fri Apr 10 20:12:25 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
sample1 ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4b01e1c0/sample1_align2genome.bam
sample2 ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4b01e1c0/sample2_align2genome.bam
sample3 ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4b01e1c0/sample3_align2genome.bam
-- Running step: isoform_identification @ Fri Apr 10 20:12:34 2026 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Fri Apr 10 20:12:35 2026 -------------------
Realignment complete for the following samples:
sample1 ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4b01e1c0/sample1_realign2transcript.bam
sample2 ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4b01e1c0/sample2_realign2transcript.bam
sample3 ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4b01e1c0/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Fri Apr 10 20:12:44 2026 ----------
2026-04-11T00:12:44.334772Z  INFO oarfish: setting user-provided filter parameters.
2026-04-11T00:12:44.335139Z  INFO oarfish::alignment_parser: read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4b01e1c0/sample1_realign2transcript.bam, contains 17 reference sequences.
2026-04-11T00:12:44.335182Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-11T00:12:44.335188Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-11T00:12:44.335258Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-11T00:12:44.335269Z  INFO oarfish: parsed reference information for 17 transcripts.
2026-04-11T00:12:44.342735Z  INFO oarfish::alignment_parser: the alignment file contained 0 unmapped read records.
2026-04-11T00:12:44.342851Z  INFO oarfish::bulk: 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 3418  │
│ aligned fraction too low        │ 7     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 0     │
│ reads with valid best alignment │ 293   │
╰─────────────────────────────────┴───────╯

2026-04-11T00:12:44.342881Z  INFO oarfish::bulk: Total number of alignment records : 520
2026-04-11T00:12:44.342890Z  INFO oarfish::bulk: number of aligned reads : 293
2026-04-11T00:12:44.342893Z  INFO oarfish::bulk: number of unique alignments : 192
2026-04-11T00:12:44.344683Z  INFO oarfish: oarfish completed successfully.
2026-04-11T00:12:44.362256Z  INFO oarfish: setting user-provided filter parameters.
2026-04-11T00:12:44.362589Z  INFO oarfish::alignment_parser: read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4b01e1c0/sample2_realign2transcript.bam, contains 17 reference sequences.
2026-04-11T00:12:44.362618Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-11T00:12:44.362623Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-11T00:12:44.362694Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-11T00:12:44.362706Z  INFO oarfish: parsed reference information for 17 transcripts.
2026-04-11T00:12:44.368785Z  INFO oarfish::alignment_parser: the alignment file contained 0 unmapped read records.
2026-04-11T00:12:44.368875Z  INFO oarfish::bulk: 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 3445  │
│ aligned fraction too low        │ 8     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 0     │
│ reads with valid best alignment │ 292   │
╰─────────────────────────────────┴───────╯

2026-04-11T00:12:44.368916Z  INFO oarfish::bulk: Total number of alignment records : 516
2026-04-11T00:12:44.368924Z  INFO oarfish::bulk: number of aligned reads : 292
2026-04-11T00:12:44.368928Z  INFO oarfish::bulk: number of unique alignments : 198
2026-04-11T00:12:44.370379Z  INFO oarfish: oarfish completed successfully.
2026-04-11T00:12:44.386788Z  INFO oarfish: setting user-provided filter parameters.
2026-04-11T00:12:44.387102Z  INFO oarfish::alignment_parser: read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4b01e1c0/sample3_realign2transcript.bam, contains 17 reference sequences.
2026-04-11T00:12:44.387132Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-11T00:12:44.387138Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-11T00:12:44.387261Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-11T00:12:44.387280Z  INFO oarfish: parsed reference information for 17 transcripts.
2026-04-11T00:12:44.393148Z  INFO oarfish::alignment_parser: the alignment file contained 0 unmapped read records.
2026-04-11T00:12:44.393232Z  INFO oarfish::bulk: 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 3451  │
│ aligned fraction too low        │ 9     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 0     │
│ reads with valid best alignment │ 291   │
╰─────────────────────────────────┴───────╯

2026-04-11T00:12:44.393255Z  INFO oarfish::bulk: Total number of alignment records : 502
2026-04-11T00:12:44.393261Z  INFO oarfish::bulk: number of aligned reads : 291
2026-04-11T00:12:44.393264Z  INFO oarfish::bulk: number of unique alignments : 199
2026-04-11T00:12:44.394972Z  INFO oarfish: oarfish completed successfully.
Testing: run_FLAMES(BulkPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44061c168/config_file_39892.json 
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Fri Apr 10 20:12:44 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample sample1 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44061c168/sample1_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample2 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44061c168/sample2_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample3 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44061c168/sample3_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: isoform_identification @ Fri Apr 10 20:12:45 2026 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Fri Apr 10 20:12:45 2026 -------------------
Realigning sample sample1 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44061c168/sample1_realign2transcript.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample sample2 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44061c168/sample2_realign2transcript.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample sample3 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44061c168/sample3_realign2transcript.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: transcript_quantification @ Fri Apr 10 20:12:46 2026 ----------
20:12:46 Fri Apr 10 2026 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
Testing: run_FLAMES(BulkPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4196debf0/config_file_39892.json 
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Fri Apr 10 20:12:46 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
sample1 ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4196debf0/sample1_align2genome.bam
sample2 ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4196debf0/sample2_align2genome.bam
sample3 ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4196debf0/sample3_align2genome.bam
-- Running step: isoform_identification @ Fri Apr 10 20:12:55 2026 -------------
Inputs:  ['/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44061c168/sample3_realign2transcript.bam', '/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44061c168/sample2_realign2transcript.bam', '/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44061c168/sample1_realign2transcript.bam'] /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44061c168/transcript_assembly.fa.fai 5 0.4 0.4
	Counter({'counted_reads': 895, 'not_enough_coverage': 5})
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Fri Apr 10 20:12:55 2026 -------------------
Realignment complete for the following samples:
sample1 ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4196debf0/sample1_realign2transcript.bam
sample2 ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4196debf0/sample2_realign2transcript.bam
sample3 ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4196debf0/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Fri Apr 10 20:13:04 2026 ----------
20:13:04 Fri Apr 10 2026 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
Testing: run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd42b447e3a/config_file_39892.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: FALSE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Apr 10 20:13:05 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd42b447e3a/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 8
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /Library/Frameworks/R.framework/Versions/4.6/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Fri Apr 10 20:13:05 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd42b447e3a/matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd42b447e3a/align2genome.bam
Sorting BAM files by genome coordinates with 8 threads...

Indexing bam files
-- Running step: isoform_identification @ Fri Apr 10 20:13:05 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---
Detected 2 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Fri Apr 10 20:13:08 2026 -------------------
Checking for fastq file(s) /Library/Frameworks/R.framework/Versions/4.6/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd42b447e3a/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd42b447e3a/matched_reads_dedup.fastq.gz
	files not found
Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd42b447e3a/matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd42b447e3a/realign2transcript.bam
Sorting BAM files by 8 with CB threads...

[bam_sort_core] merging from 0 files and 8 in-memory blocks...
-- Running step: transcript_quantification @ Fri Apr 10 20:13:08 2026 ----------
2026-04-11T00:13:08.942930Z  INFO oarfish: setting user-provided filter parameters.
2026-04-11T00:13:08.943354Z  INFO oarfish::alignment_parser: read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd42b447e3a/realign2transcript.bam, contains 5 reference sequences.
2026-04-11T00:13:08.943374Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-11T00:13:08.943378Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-11T00:13:08.943426Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-11T00:13:08.943435Z  INFO oarfish: parsed reference information for 5 transcripts.
2026-04-11T00:13:08.948877Z  INFO oarfish::single_cell: Processed 100 cells.
Testing: run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd419072859/config_file_39892.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: FALSE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Apr 10 20:13:09 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd419072859/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 8
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /Library/Frameworks/R.framework/Versions/4.6/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Fri Apr 10 20:13:09 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd419072859/matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd419072859/align2genome.bam
-- Running step: isoform_identification @ Fri Apr 10 20:13:17 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---
Detected 2 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Fri Apr 10 20:13:20 2026 -------------------
Checking for fastq file(s) /Library/Frameworks/R.framework/Versions/4.6/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd419072859/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd419072859/matched_reads_dedup.fastq.gz
	files not found
Realignment complete for the following samples:
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd419072859/matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd419072859/realign2transcript.bam
-- Running step: transcript_quantification @ Fri Apr 10 20:13:28 2026 ----------
2026-04-11T00:13:28.677748Z  INFO oarfish: setting user-provided filter parameters.
2026-04-11T00:13:28.678090Z  INFO oarfish::alignment_parser: read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd419072859/realign2transcript.bam, contains 5 reference sequences.
2026-04-11T00:13:28.678143Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-11T00:13:28.678156Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-11T00:13:28.678288Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-11T00:13:28.678333Z  INFO oarfish: parsed reference information for 5 transcripts.
2026-04-11T00:13:28.683136Z  INFO oarfish::single_cell: Processed 100 cells.
Testing: run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4328599b9/config_file_39892.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: FALSE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Apr 10 20:13:28 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4328599b9/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 8
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /Library/Frameworks/R.framework/Versions/4.6/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Fri Apr 10 20:13:29 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4328599b9/matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4328599b9/align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 8 threads...

Indexing bam files
-- Running step: isoform_identification @ Fri Apr 10 20:13:29 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---
Detected 2 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Fri Apr 10 20:13:32 2026 -------------------
Checking for fastq file(s) /Library/Frameworks/R.framework/Versions/4.6/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4328599b9/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4328599b9/matched_reads_dedup.fastq.gz
	files not found
Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4328599b9/matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4328599b9/realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 8 threads...

[bam_sort_core] merging from 0 files and 8 in-memory blocks...
Indexing bam files
-- Running step: transcript_quantification @ Fri Apr 10 20:13:32 2026 ----------
20:13:32 Fri Apr 10 2026 quantify transcripts 
Found realignment file(s): 	realign2transcript.bam
Inputs:  ['/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4196debf0/sample3_realign2transcript.bam', '/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4196debf0/sample2_realign2transcript.bam', '/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4196debf0/sample1_realign2transcript.bam'] /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4196debf0/transcript_assembly.fa.fai 5 0.4 0.4
	Counter({'counted_reads': 895, 'not_enough_coverage': 5})
Testing: run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd41d0bb9eb/config_file_39892.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: FALSE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Apr 10 20:13:32 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd41d0bb9eb/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 8
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /Library/Frameworks/R.framework/Versions/4.6/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Fri Apr 10 20:13:32 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd41d0bb9eb/matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd41d0bb9eb/align2genome.bam
-- Running step: isoform_identification @ Fri Apr 10 20:13:40 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---
Detected 2 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Fri Apr 10 20:13:44 2026 -------------------
Checking for fastq file(s) /Library/Frameworks/R.framework/Versions/4.6/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd41d0bb9eb/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd41d0bb9eb/matched_reads_dedup.fastq.gz
	files not found
Realignment complete for the following samples:
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd41d0bb9eb/matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd41d0bb9eb/realign2transcript.bam
-- Running step: transcript_quantification @ Fri Apr 10 20:13:52 2026 ----------
20:13:52 Fri Apr 10 2026 quantify transcripts 
Found realignment file(s): 	realign2transcript.bam
	Counter({'counted_reads': 354, 'not_enough_coverage': 12, 'unmapped': 6})
Testing: run_FLAMES(SingleCellPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd46b894174/config_file_39892.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: FALSE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Apr 10 20:13:52 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd46b894174/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 8
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /Library/Frameworks/R.framework/Versions/4.6/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Fri Apr 10 20:13:52 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd46b894174/matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd46b894174/align2genome.bam
Sorting BAM files by genome coordinates with 8 threads...

Indexing bam files
-- Running step: isoform_identification @ Fri Apr 10 20:13:52 2026 -------------
	Counter({'counted_reads': 354, 'not_enough_coverage': 12, 'unmapped': 6})
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Fri Apr 10 20:13:52 2026 -------------------
Checking for fastq file(s) /Library/Frameworks/R.framework/Versions/4.6/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd46b894174/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd46b894174/matched_reads_dedup.fastq.gz
	files not found
Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd46b894174/matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd46b894174/realign2transcript.bam
Sorting BAM files by 8 with CB threads...

[bam_sort_core] merging from 0 files and 8 in-memory blocks...
-- Running step: transcript_quantification @ Fri Apr 10 20:13:53 2026 ----------
2026-04-11T00:13:53.051277Z  INFO oarfish: setting user-provided filter parameters.
2026-04-11T00:13:53.051673Z  INFO oarfish::alignment_parser: read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd46b894174/realign2transcript.bam, contains 10 reference sequences.
2026-04-11T00:13:53.051717Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-11T00:13:53.051730Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-11T00:13:53.051828Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-11T00:13:53.051847Z  INFO oarfish: parsed reference information for 10 transcripts.
2026-04-11T00:13:53.059067Z  INFO oarfish::single_cell: Processed 100 cells.
Testing: run_FLAMES(SingleCellPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd41f315ea1/config_file_39892.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: FALSE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Apr 10 20:13:53 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd41f315ea1/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 8
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /Library/Frameworks/R.framework/Versions/4.6/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Fri Apr 10 20:13:53 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd41f315ea1/matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd41f315ea1/align2genome.bam
-- Running step: isoform_identification @ Fri Apr 10 20:14:01 2026 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Fri Apr 10 20:14:01 2026 -------------------
Checking for fastq file(s) /Library/Frameworks/R.framework/Versions/4.6/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd41f315ea1/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd41f315ea1/matched_reads_dedup.fastq.gz
	files not found
Realignment complete for the following samples:
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd41f315ea1/matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd41f315ea1/realign2transcript.bam
-- Running step: transcript_quantification @ Fri Apr 10 20:14:09 2026 ----------
2026-04-11T00:14:09.709150Z  INFO oarfish: setting user-provided filter parameters.
2026-04-11T00:14:09.709489Z  INFO oarfish::alignment_parser: read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd41f315ea1/realign2transcript.bam, contains 10 reference sequences.
2026-04-11T00:14:09.709517Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-11T00:14:09.709522Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-11T00:14:09.709575Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-11T00:14:09.709586Z  INFO oarfish: parsed reference information for 10 transcripts.
2026-04-11T00:14:09.716508Z  INFO oarfish::single_cell: Processed 100 cells.
Testing: run_FLAMES(SingleCellPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd472c467c4/config_file_39892.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: FALSE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Apr 10 20:14:10 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd472c467c4/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 8
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /Library/Frameworks/R.framework/Versions/4.6/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Fri Apr 10 20:14:10 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd472c467c4/matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd472c467c4/align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 8 threads...

Indexing bam files
-- Running step: isoform_identification @ Fri Apr 10 20:14:10 2026 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Fri Apr 10 20:14:10 2026 -------------------
Checking for fastq file(s) /Library/Frameworks/R.framework/Versions/4.6/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd472c467c4/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd472c467c4/matched_reads_dedup.fastq.gz
	files not found
Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd472c467c4/matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd472c467c4/realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 8 threads...

[bam_sort_core] merging from 0 files and 8 in-memory blocks...
Indexing bam files
-- Running step: transcript_quantification @ Fri Apr 10 20:14:10 2026 ----------
20:14:10 Fri Apr 10 2026 quantify transcripts 
Found realignment file(s): 	realign2transcript.bam
Testing: run_FLAMES(SingleCellPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd42334d0a0/config_file_39892.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: FALSE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Apr 10 20:14:11 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd42334d0a0/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 8
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /Library/Frameworks/R.framework/Versions/4.6/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Fri Apr 10 20:14:11 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd42334d0a0/matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd42334d0a0/align2genome.bam
-- Running step: isoform_identification @ Fri Apr 10 20:14:19 2026 -------------
	Counter({'counted_reads': 368, 'unmapped': 4})
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Fri Apr 10 20:14:19 2026 -------------------
Checking for fastq file(s) /Library/Frameworks/R.framework/Versions/4.6/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd42334d0a0/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd42334d0a0/matched_reads_dedup.fastq.gz
	files not found
Realignment complete for the following samples:
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd42334d0a0/matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd42334d0a0/realign2transcript.bam
-- Running step: transcript_quantification @ Fri Apr 10 20:14:27 2026 ----------
20:14:27 Fri Apr 10 2026 quantify transcripts 
Found realignment file(s): 	realign2transcript.bam
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/config_file_39892.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Apr 10 20:14:28 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 993
Number of reads where at least one barcode was found: 931
Number of chimera reads: 2
All done!
Reads	Barcodes
26	1
23	2
21	2
20	1
19	2
18	2
17	1
16	2
15	2
14	4
13	1
12	5
11	7
10	3
9	5
8	4
7	5
6	12
5	14
4	4
3	34
2	22
1	2
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 283
Number of chimera reads: 1
All done!
Reads	Barcodes
9	1
7	3
6	4
5	4
4	15
3	15
2	26
1	55
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 280
Number of chimera reads: 0
All done!
Reads	Barcodes
8	1
7	1
6	8
5	5
4	12
3	15
2	21
1	60
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Fri Apr 10 20:14:29 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/sampleA_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/sampleA_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/sample1_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/sample1_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/sample2_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/sample2_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/sample3_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/sample3_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: gene_quantification @ Fri Apr 10 20:14:30 2026 ----------------
20:14:30 Fri Apr 10 2026 quantify genes 
Using BAM(s):
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/sampleA_align2genome.bam',
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/sample1_align2genome.bam',
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/sample2_align2genome.bam',
and
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/sample3_align2genome.bam'
	Counter({'counted_reads': 368, 'unmapped': 4})
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 41.77gene_group/s]
2026-04-10 20:14:31.102 R[39892:183301608] +[NSXPCSharedListener endpointForReply:withListenerName:replyErrorCode:]: an error occurred while attempting to obtain endpoint for listener 'ClientCallsAuxiliary': Connection interrupted
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 407815.81Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 81.16gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1236236.74Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 77.21gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1261368.94Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 64.60gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 964917.64Read/s]
-- Running step: isoform_identification @ Fri Apr 10 20:14:31 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |==================                                                    |  25%
  |                                                                            
  |===================================                                   |  50%
  |                                                                            
  |====================================================                  |  75%
  |                                                                            
  |======================================================================| 100%

Detected 8 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Fri Apr 10 20:14:39 2026 -------------------
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/fastq, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/fastq/sample1.fq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/fastq/sample2.fq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/sampleA_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/sample1_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/sample2_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/sampleA_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/sample1_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/sample2_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/sample3_matched_reads_dedup.fastq.gz
	files found
Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/sampleA_matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/sampleA_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/sample1_matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/sample1_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/sample2_matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/sample2_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/sample3_matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/sample3_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

-- Running step: transcript_quantification @ Fri Apr 10 20:14:40 2026 ----------
2026-04-11T00:14:40.184427Z  INFO oarfish: setting user-provided filter parameters.
2026-04-11T00:14:40.184682Z  INFO oarfish::alignment_parser: read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/sampleA_realign2transcript.bam, contains 6 reference sequences.
2026-04-11T00:14:40.184707Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-11T00:14:40.184713Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-11T00:14:40.184771Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-11T00:14:40.184780Z  INFO oarfish: parsed reference information for 6 transcripts.
2026-04-11T00:14:40.192220Z  INFO oarfish::single_cell: Processed 100 cells.
2026-04-11T00:14:40.300433Z  INFO oarfish: setting user-provided filter parameters.
2026-04-11T00:14:40.300669Z  INFO oarfish::alignment_parser: read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/sample1_realign2transcript.bam, contains 6 reference sequences.
2026-04-11T00:14:40.300693Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-11T00:14:40.300699Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-11T00:14:40.300743Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-11T00:14:40.300751Z  INFO oarfish: parsed reference information for 6 transcripts.
2026-04-11T00:14:40.302935Z  INFO oarfish::single_cell: Processed 100 cells.
2026-04-11T00:14:40.408429Z  INFO oarfish: setting user-provided filter parameters.
2026-04-11T00:14:40.408682Z  INFO oarfish::alignment_parser: read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/sample2_realign2transcript.bam, contains 6 reference sequences.
2026-04-11T00:14:40.408715Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-11T00:14:40.408723Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-11T00:14:40.408788Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-11T00:14:40.408804Z  INFO oarfish: parsed reference information for 6 transcripts.
2026-04-11T00:14:40.412662Z  INFO oarfish::single_cell: Processed 100 cells.
2026-04-11T00:14:40.521566Z  INFO oarfish: setting user-provided filter parameters.
2026-04-11T00:14:40.521839Z  INFO oarfish::alignment_parser: read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd452f436de/sample3_realign2transcript.bam, contains 6 reference sequences.
2026-04-11T00:14:40.521879Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-11T00:14:40.521893Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-11T00:14:40.521948Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-11T00:14:40.521957Z  INFO oarfish: parsed reference information for 6 transcripts.
2026-04-11T00:14:40.524672Z  INFO oarfish::single_cell: Processed 100 cells.
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/config_file_39892.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Apr 10 20:14:40 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 993
Number of reads where at least one barcode was found: 933
Number of chimera reads: 2
All done!
Reads	Barcodes
27	1
24	1
23	1
22	3
21	1
19	3
18	2
16	3
15	2
14	3
13	1
12	2
11	7
10	3
9	4
8	9
7	3
6	6
5	17
4	7
3	34
2	22
1	2
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 285
Number of chimera reads: 0
All done!
Reads	Barcodes
9	1
8	1
7	2
6	6
5	7
4	12
3	13
2	19
1	61
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 280
Number of chimera reads: 1
All done!
Reads	Barcodes
9	1
8	3
7	2
6	2
5	10
4	7
3	13
2	26
1	56
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Fri Apr 10 20:14:41 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/sampleA_matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/sampleA_align2genome.bam
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/sample1_matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/sample1_align2genome.bam
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/sample2_matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/sample2_align2genome.bam
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/sample3_matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/sample3_align2genome.bam
-- Running step: gene_quantification @ Fri Apr 10 20:14:51 2026 ----------------
20:14:51 Fri Apr 10 2026 quantify genes 
Using BAM(s):
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/sampleA_align2genome.bam',
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/sample1_align2genome.bam',
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/sample2_align2genome.bam',
and
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/sample3_align2genome.bam'
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 46.82gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 394765.45Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 84.75gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1147238.51Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 65.82gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1096492.73Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 59.43gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 897369.28Read/s]
-- Running step: isoform_identification @ Fri Apr 10 20:14:51 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |==================                                                    |  25%
  |                                                                            
  |===================================                                   |  50%
  |                                                                            
  |====================================================                  |  75%
  |                                                                            
  |======================================================================| 100%

Detected 8 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Fri Apr 10 20:14:59 2026 -------------------
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/fastq, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/fastq/sample1.fq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/fastq/sample2.fq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/sampleA_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/sample1_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/sample2_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/sampleA_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/sample1_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/sample2_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/sample3_matched_reads_dedup.fastq.gz
	files found
Realignment complete for the following samples:
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/sampleA_matched_reads_dedup.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/sampleA_realign2transcript.bam
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/sample1_matched_reads_dedup.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/sample1_realign2transcript.bam
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/sample2_matched_reads_dedup.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/sample2_realign2transcript.bam
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/sample3_matched_reads_dedup.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Fri Apr 10 20:15:08 2026 ----------
2026-04-11T00:15:08.722186Z  INFO oarfish: setting user-provided filter parameters.
2026-04-11T00:15:08.722404Z  INFO oarfish::alignment_parser: read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/sampleA_realign2transcript.bam, contains 6 reference sequences.
2026-04-11T00:15:08.722423Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-11T00:15:08.722428Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-11T00:15:08.722473Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-11T00:15:08.722482Z  INFO oarfish: parsed reference information for 6 transcripts.
2026-04-11T00:15:08.727793Z  INFO oarfish::single_cell: Processed 100 cells.
2026-04-11T00:15:08.864395Z  INFO oarfish: setting user-provided filter parameters.
2026-04-11T00:15:08.864705Z  INFO oarfish::alignment_parser: read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/sample1_realign2transcript.bam, contains 6 reference sequences.
2026-04-11T00:15:08.864739Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-11T00:15:08.864746Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-11T00:15:08.864805Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-11T00:15:08.864823Z  INFO oarfish: parsed reference information for 6 transcripts.
2026-04-11T00:15:08.868457Z  INFO oarfish::single_cell: Processed 100 cells.
2026-04-11T00:15:09.003963Z  INFO oarfish: setting user-provided filter parameters.
2026-04-11T00:15:09.004210Z  INFO oarfish::alignment_parser: read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/sample2_realign2transcript.bam, contains 6 reference sequences.
2026-04-11T00:15:09.004231Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-11T00:15:09.004237Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-11T00:15:09.004290Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-11T00:15:09.004306Z  INFO oarfish: parsed reference information for 6 transcripts.
2026-04-11T00:15:09.008180Z  INFO oarfish::single_cell: Processed 100 cells.
2026-04-11T00:15:09.134656Z  INFO oarfish: setting user-provided filter parameters.
2026-04-11T00:15:09.134903Z  INFO oarfish::alignment_parser: read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4d567040/sample3_realign2transcript.bam, contains 6 reference sequences.
2026-04-11T00:15:09.134923Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-11T00:15:09.134929Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-11T00:15:09.134971Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-11T00:15:09.134980Z  INFO oarfish: parsed reference information for 6 transcripts.
2026-04-11T00:15:09.150492Z  INFO oarfish::single_cell: Processed 100 cells.
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/config_file_39892.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Apr 10 20:15:09 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 993
Number of reads where at least one barcode was found: 931
Number of chimera reads: 2
All done!
Reads	Barcodes
24	3
23	1
22	2
21	2
19	1
18	3
17	1
16	1
15	1
14	5
13	2
12	2
11	3
10	5
9	5
8	8
7	4
6	14
5	12
4	4
3	30
2	22
1	6
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 283
Number of chimera reads: 1
All done!
Reads	Barcodes
8	2
7	5
6	5
5	3
4	14
3	9
2	32
1	44
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 280
Number of chimera reads: 0
All done!
Reads	Barcodes
8	3
7	3
6	3
5	5
4	11
3	14
2	25
1	59
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Fri Apr 10 20:15:10 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sampleA_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sampleA_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sample1_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sample1_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sample2_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sample2_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sample3_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sample3_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: gene_quantification @ Fri Apr 10 20:15:11 2026 ----------------
20:15:11 Fri Apr 10 2026 quantify genes 
Using BAM(s):
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sampleA_align2genome.bam',
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sample1_align2genome.bam',
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sample2_align2genome.bam',
and
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sample3_align2genome.bam'
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 45.35gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 372919.84Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 86.53gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 484420.22Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 88.41gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1339006.51Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 64.71gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 996840.00Read/s]
-- Running step: isoform_identification @ Fri Apr 10 20:15:12 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |==================                                                    |  25%
  |                                                                            
  |===================================                                   |  50%
  |                                                                            
  |====================================================                  |  75%
  |                                                                            
  |======================================================================| 100%

Detected 8 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Fri Apr 10 20:15:19 2026 -------------------
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/fastq, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/fastq/sample1.fq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/fastq/sample2.fq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sampleA_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sample1_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sample2_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sampleA_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sample1_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sample2_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sample3_matched_reads_dedup.fastq.gz
	files found
Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sampleA_matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sampleA_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sample1_matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sample1_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sample2_matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sample2_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sample3_matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sample3_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: transcript_quantification @ Fri Apr 10 20:15:20 2026 ----------
20:15:20 Fri Apr 10 2026 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
	sampleA_realign2transcript.bam
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sample3_realign2transcript.bam...
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sample3_realign2transcript.bamdone
wrt_tr_to_csv for/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sample3_realign2transcript.bamdone
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sampleA_realign2transcript.bam...
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sampleA_realign2transcript.bamdone
wrt_tr_to_csv for/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sampleA_realign2transcript.bamdone
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sample2_realign2transcript.bam...
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sample2_realign2transcript.bamdone
wrt_tr_to_csv for/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sample2_realign2transcript.bamdone
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sample1_realign2transcript.bam...
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sample1_realign2transcript.bamdone
wrt_tr_to_csv for/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd440bdc4d/sample1_realign2transcript.bamdone
annotate_full_splice_match_all_sample...
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/config_file_39892.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Apr 10 20:15:21 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 993
Number of reads where at least one barcode was found: 931
Number of chimera reads: 3
All done!
Reads	Barcodes
26	1
24	1
23	2
22	1
20	2
19	2
18	1
17	3
16	1
15	3
14	2
13	1
12	5
11	5
10	5
9	8
8	4
7	2
6	8
5	15
4	7
3	30
2	23
1	5
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 282
Number of chimera reads: 1
All done!
Reads	Barcodes
9	1
7	6
6	2
5	5
4	11
3	17
2	23
1	57
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 281
Number of chimera reads: 1
All done!
Reads	Barcodes
9	1
8	1
7	3
6	2
5	12
4	8
3	17
2	20
1	51
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Fri Apr 10 20:15:22 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sampleA_matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sampleA_align2genome.bam
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sample1_matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sample1_align2genome.bam
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sample2_matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sample2_align2genome.bam
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sample3_matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sample3_align2genome.bam
-- Running step: gene_quantification @ Fri Apr 10 20:15:31 2026 ----------------
20:15:31 Fri Apr 10 2026 quantify genes 
Using BAM(s):
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sampleA_align2genome.bam',
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sample1_align2genome.bam',
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sample2_align2genome.bam',
and
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sample3_align2genome.bam'
	Counter({'counted_reads': 347, 'not_enough_coverage': 9, 'unmapped': 2})
	Counter({'counted_reads': 347, 'not_enough_coverage': 9, 'unmapped': 4})
	Counter({'counted_reads': 267, 'not_enough_coverage': 7, 'unmapped': 1})
	Counter({'counted_reads': 269, 'not_enough_coverage': 8, 'unmapped': 1})
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 45.61gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 376508.44Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 89.13gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1162114.60Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 87.17gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1364622.59Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 74.84gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 899293.31Read/s]
-- Running step: isoform_identification @ Fri Apr 10 20:15:32 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |==================                                                    |  25%
  |                                                                            
  |===================================                                   |  50%
  |                                                                            
  |====================================================                  |  75%
  |                                                                            
  |======================================================================| 100%

Detected 8 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Fri Apr 10 20:15:39 2026 -------------------
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/fastq, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/fastq/sample1.fq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/fastq/sample2.fq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sampleA_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sample1_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sample2_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sampleA_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sample1_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sample2_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sample3_matched_reads_dedup.fastq.gz
	files found
Realignment complete for the following samples:
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sampleA_matched_reads_dedup.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sampleA_realign2transcript.bam
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sample1_matched_reads_dedup.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sample1_realign2transcript.bam
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sample2_matched_reads_dedup.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sample2_realign2transcript.bam
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sample3_matched_reads_dedup.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Fri Apr 10 20:15:48 2026 ----------
20:15:48 Fri Apr 10 2026 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
	sampleA_realign2transcript.bam
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sample3_realign2transcript.bam...
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sample3_realign2transcript.bamdone
wrt_tr_to_csv for/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sample3_realign2transcript.bamdone
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sampleA_realign2transcript.bam...
	Counter({'counted_reads': 347, 'not_enough_coverage': 9, 'unmapped': 2})
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sampleA_realign2transcript.bamdone
wrt_tr_to_csv for/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sampleA_realign2transcript.bamdone
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sample2_realign2transcript.bam...
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sample2_realign2transcript.bamdone
wrt_tr_to_csv for/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sample2_realign2transcript.bamdone
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sample1_realign2transcript.bam...
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sample1_realign2transcript.bamdone
wrt_tr_to_csv for/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd44d2eefda/sample1_realign2transcript.bamdone
annotate_full_splice_match_all_sample...
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/config_file_39892.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Apr 10 20:15:48 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 993
Number of reads where at least one barcode was found: 928
Number of chimera reads: 2
All done!
Reads	Barcodes
25	2
23	1
22	3
21	1
20	2
19	3
17	1
15	2
14	3
13	2
12	3
11	6
10	4
9	6
8	7
7	3
6	11
5	8
4	10
3	32
2	25
1	2
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 278
Number of chimera reads: 0
All done!
Reads	Barcodes
8	4
7	3
6	6
5	4
4	8
3	12
2	23
1	58
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 282
Number of chimera reads: 1
All done!
Reads	Barcodes
7	7
6	2
5	5
4	12
3	14
2	29
1	52
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Fri Apr 10 20:15:49 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/sampleA_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/sampleA_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/sample1_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/sample1_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/sample2_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/sample2_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/sample3_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/sample3_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: gene_quantification @ Fri Apr 10 20:15:51 2026 ----------------
20:15:51 Fri Apr 10 2026 quantify genes 
Using BAM(s):
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/sampleA_align2genome.bam',
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/sample1_align2genome.bam',
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/sample2_align2genome.bam',
and
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/sample3_align2genome.bam'
	Counter({'counted_reads': 347, 'not_enough_coverage': 9, 'unmapped': 4})
	Counter({'counted_reads': 265, 'not_enough_coverage': 8, 'unmapped': 1})
	Counter({'counted_reads': 265, 'not_enough_coverage': 7, 'unmapped': 1})
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 41.69gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 379259.26Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 88.53gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1280781.73Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 94.87gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1420449.74Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 69.88gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1034915.12Read/s]
-- Running step: isoform_identification @ Fri Apr 10 20:15:51 2026 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Fri Apr 10 20:15:51 2026 -------------------
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/fastq, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/fastq/sample1.fq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/fastq/sample2.fq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/sampleA_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/sample1_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/sample2_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/sampleA_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/sample1_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/sample2_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/sample3_matched_reads_dedup.fastq.gz
	files found
Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/sampleA_matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/sampleA_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/sample1_matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/sample1_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/sample2_matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/sample2_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/sample3_matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/sample3_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

-- Running step: transcript_quantification @ Fri Apr 10 20:15:55 2026 ----------
2026-04-11T00:15:55.699484Z  INFO oarfish: setting user-provided filter parameters.
2026-04-11T00:15:55.699798Z  INFO oarfish::alignment_parser: read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/sampleA_realign2transcript.bam, contains 31 reference sequences.
2026-04-11T00:15:55.699835Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-11T00:15:55.699841Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-11T00:15:55.699925Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-11T00:15:55.699939Z  INFO oarfish: parsed reference information for 31 transcripts.
2026-04-11T00:15:55.719542Z  INFO oarfish::single_cell: Processed 100 cells.
2026-04-11T00:15:55.911782Z  INFO oarfish: setting user-provided filter parameters.
2026-04-11T00:15:55.912048Z  INFO oarfish::alignment_parser: read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/sample1_realign2transcript.bam, contains 31 reference sequences.
2026-04-11T00:15:55.912080Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-11T00:15:55.912087Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-11T00:15:55.912186Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-11T00:15:55.912209Z  INFO oarfish: parsed reference information for 31 transcripts.
2026-04-11T00:15:55.920341Z  INFO oarfish::single_cell: Processed 100 cells.
2026-04-11T00:15:56.097114Z  INFO oarfish: setting user-provided filter parameters.
2026-04-11T00:15:56.097406Z  INFO oarfish::alignment_parser: read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/sample2_realign2transcript.bam, contains 31 reference sequences.
2026-04-11T00:15:56.097440Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-11T00:15:56.097447Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-11T00:15:56.097537Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-11T00:15:56.097558Z  INFO oarfish: parsed reference information for 31 transcripts.
2026-04-11T00:15:56.105687Z  INFO oarfish::single_cell: Processed 100 cells.
2026-04-11T00:15:56.301477Z  INFO oarfish: setting user-provided filter parameters.
2026-04-11T00:15:56.301811Z  INFO oarfish::alignment_parser: read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd418667ce0/sample3_realign2transcript.bam, contains 31 reference sequences.
2026-04-11T00:15:56.301845Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-11T00:15:56.301852Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-11T00:15:56.301960Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-11T00:15:56.301977Z  INFO oarfish: parsed reference information for 31 transcripts.
2026-04-11T00:15:56.310833Z  INFO oarfish::single_cell: Processed 100 cells.
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/config_file_39892.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Apr 10 20:15:56 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 993
Number of reads where at least one barcode was found: 932
Number of chimera reads: 3
All done!
Reads	Barcodes
26	2
24	1
22	1
21	3
20	1
19	3
16	3
15	1
14	2
13	1
12	2
11	8
10	8
9	3
8	5
7	5
6	16
5	10
4	5
3	33
2	18
1	6
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 281
Number of chimera reads: 1
All done!
Reads	Barcodes
9	1
8	1
7	1
6	6
5	5
4	12
3	14
2	28
1	53
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 283
Number of chimera reads: 1
All done!
Reads	Barcodes
9	1
8	1
7	7
6	3
5	1
4	10
3	13
2	34
1	51
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Fri Apr 10 20:15:57 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/sampleA_matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/sampleA_align2genome.bam
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/sample1_matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/sample1_align2genome.bam
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/sample2_matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/sample2_align2genome.bam
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/sample3_matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/sample3_align2genome.bam
-- Running step: gene_quantification @ Fri Apr 10 20:16:06 2026 ----------------
20:16:06 Fri Apr 10 2026 quantify genes 
Using BAM(s):
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/sampleA_align2genome.bam',
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/sample1_align2genome.bam',
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/sample2_align2genome.bam',
and
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/sample3_align2genome.bam'
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 18.71gene_group/s]
/Library/Frameworks/R.framework/Versions/4.6/Resources/library/FLAMES/python/count_gene.py:705: RuntimeWarning: More than 20 figures have been opened. Figures created through the pyplot interface (`matplotlib.pyplot.figure`) are retained until explicitly closed and may consume too much memory. (To control this warning, see the rcParam `figure.max_open_warning`). Consider using `matplotlib.pyplot.close()`.
  plt.figure(figsize=(8, 6))
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 371098.53Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 89.30gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1376625.97Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 88.13gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1145734.27Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 68.36gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 960410.33Read/s]
-- Running step: isoform_identification @ Fri Apr 10 20:16:07 2026 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Fri Apr 10 20:16:07 2026 -------------------
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/fastq, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/fastq/sample1.fq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/fastq/sample2.fq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/sampleA_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/sample1_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/sample2_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/sampleA_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/sample1_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/sample2_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/sample3_matched_reads_dedup.fastq.gz
	files found
Realignment complete for the following samples:
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/sampleA_matched_reads_dedup.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/sampleA_realign2transcript.bam
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/sample1_matched_reads_dedup.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/sample1_realign2transcript.bam
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/sample2_matched_reads_dedup.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/sample2_realign2transcript.bam
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/sample3_matched_reads_dedup.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Fri Apr 10 20:16:18 2026 ----------
2026-04-11T00:16:18.430729Z  INFO oarfish: setting user-provided filter parameters.
2026-04-11T00:16:18.430995Z  INFO oarfish::alignment_parser: read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/sampleA_realign2transcript.bam, contains 28 reference sequences.
2026-04-11T00:16:18.431010Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-11T00:16:18.431016Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-11T00:16:18.431131Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-11T00:16:18.431145Z  INFO oarfish: parsed reference information for 28 transcripts.
2026-04-11T00:16:18.446127Z  INFO oarfish::single_cell: Processed 100 cells.
2026-04-11T00:16:18.687593Z  INFO oarfish: setting user-provided filter parameters.
2026-04-11T00:16:18.687822Z  INFO oarfish::alignment_parser: read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/sample1_realign2transcript.bam, contains 28 reference sequences.
2026-04-11T00:16:18.687848Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-11T00:16:18.687854Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-11T00:16:18.687932Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-11T00:16:18.687950Z  INFO oarfish: parsed reference information for 28 transcripts.
2026-04-11T00:16:18.696303Z  INFO oarfish::single_cell: Processed 100 cells.
2026-04-11T00:16:18.930459Z  INFO oarfish: setting user-provided filter parameters.
2026-04-11T00:16:18.930743Z  INFO oarfish::alignment_parser: read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/sample2_realign2transcript.bam, contains 28 reference sequences.
2026-04-11T00:16:18.930777Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-11T00:16:18.930791Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-11T00:16:18.930890Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-11T00:16:18.930910Z  INFO oarfish: parsed reference information for 28 transcripts.
2026-04-11T00:16:18.938906Z  INFO oarfish::single_cell: Processed 100 cells.
2026-04-11T00:16:19.134189Z  INFO oarfish: setting user-provided filter parameters.
2026-04-11T00:16:19.134496Z  INFO oarfish::alignment_parser: read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4c74547f/sample3_realign2transcript.bam, contains 28 reference sequences.
2026-04-11T00:16:19.134537Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-11T00:16:19.134546Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-11T00:16:19.134639Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-11T00:16:19.134660Z  INFO oarfish: parsed reference information for 28 transcripts.
2026-04-11T00:16:19.143690Z  INFO oarfish::single_cell: Processed 100 cells.
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/config_file_39892.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Apr 10 20:16:19 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 993
Number of reads where at least one barcode was found: 933
Number of chimera reads: 3
All done!
Reads	Barcodes
27	1
25	1
23	1
22	4
19	3
18	1
16	2
15	3
13	2
12	4
11	4
10	8
9	7
8	8
7	1
6	14
5	12
4	2
3	33
2	19
1	7
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 283
Number of chimera reads: 1
All done!
Reads	Barcodes
8	2
7	4
6	4
5	5
4	9
3	16
2	31
1	48
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 282
Number of chimera reads: 1
All done!
Reads	Barcodes
9	1
8	1
7	5
6	2
5	2
4	13
3	19
2	25
1	51
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Fri Apr 10 20:16:20 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sampleA_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sampleA_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sample1_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sample1_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sample2_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sample2_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sample3_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sample3_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: gene_quantification @ Fri Apr 10 20:16:21 2026 ----------------
20:16:21 Fri Apr 10 2026 quantify genes 
Using BAM(s):
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sampleA_align2genome.bam',
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sample1_align2genome.bam',
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sample2_align2genome.bam',
and
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sample3_align2genome.bam'
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 46.22gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 342694.29Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 85.58gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1328488.53Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 84.71gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1294058.99Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 75.09gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 965984.34Read/s]
-- Running step: isoform_identification @ Fri Apr 10 20:16:22 2026 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Fri Apr 10 20:16:22 2026 -------------------
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/fastq, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/fastq/sample1.fq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/fastq/sample2.fq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sampleA_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sample1_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sample2_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sampleA_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sample1_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sample2_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sample3_matched_reads_dedup.fastq.gz
	files found
Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sampleA_matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sampleA_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sample1_matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sample1_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sample2_matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sample2_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sample3_matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sample3_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: transcript_quantification @ Fri Apr 10 20:16:24 2026 ----------
20:16:24 Fri Apr 10 2026 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
	sampleA_realign2transcript.bam
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sample3_realign2transcript.bam...
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sample3_realign2transcript.bamdone
wrt_tr_to_csv for/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sample3_realign2transcript.bamdone
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sampleA_realign2transcript.bam...
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sampleA_realign2transcript.bamdone
wrt_tr_to_csv for/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sampleA_realign2transcript.bamdone
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sample2_realign2transcript.bam...
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sample2_realign2transcript.bamdone
wrt_tr_to_csv for/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sample2_realign2transcript.bamdone
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sample1_realign2transcript.bam...
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sample1_realign2transcript.bamdone
wrt_tr_to_csv for/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd4784d6a95/sample1_realign2transcript.bamdone
annotate_full_splice_match_all_sample...
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/config_file_39892.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Apr 10 20:16:25 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 993
Number of reads where at least one barcode was found: 924
Number of chimera reads: 2
All done!
Reads	Barcodes
26	1
25	1
23	1
21	1
20	3
19	2
18	1
17	4
14	3
13	2
12	1
11	5
10	8
9	6
8	8
7	3
6	13
5	13
4	3
3	33
2	20
1	5
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 279
Number of chimera reads: 0
All done!
Reads	Barcodes
9	1
8	1
7	4
6	2
5	6
4	11
3	12
2	31
1	52
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 277
Number of chimera reads: 1
All done!
Reads	Barcodes
8	1
7	2
6	5
5	7
4	7
3	16
2	31
1	54
Loading known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Fri Apr 10 20:16:26 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sampleA_matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sampleA_align2genome.bam
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sample1_matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sample1_align2genome.bam
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sample2_matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sample2_align2genome.bam
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sample3_matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sample3_align2genome.bam
-- Running step: gene_quantification @ Fri Apr 10 20:16:35 2026 ----------------
20:16:35 Fri Apr 10 2026 quantify genes 
Using BAM(s):
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sampleA_align2genome.bam',
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sample1_align2genome.bam',
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sample2_align2genome.bam',
and
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sample3_align2genome.bam'
	Counter({'counted_reads': 357, 'not_enough_coverage': 1})
	Counter({'counted_reads': 357, 'not_enough_coverage': 1})
	Counter({'counted_reads': 273})
	Counter({'counted_reads': 276, 'not_enough_coverage': 1})
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 45.99gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 380677.44Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 85.25gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1195639.68Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 91.17gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1296458.95Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 15.96gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 975419.53Read/s]
-- Running step: isoform_identification @ Fri Apr 10 20:16:36 2026 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Fri Apr 10 20:16:36 2026 -------------------
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/fastq, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/fastq/sample1.fq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/fastq/sample2.fq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sampleA_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sample1_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sample2_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sampleA_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sample1_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sample2_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sample3_matched_reads_dedup.fastq.gz
	files found
Realignment complete for the following samples:
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sampleA_matched_reads_dedup.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sampleA_realign2transcript.bam
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sample1_matched_reads_dedup.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sample1_realign2transcript.bam
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sample2_matched_reads_dedup.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sample2_realign2transcript.bam
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sample3_matched_reads_dedup.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Fri Apr 10 20:16:45 2026 ----------
20:16:45 Fri Apr 10 2026 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
	sampleA_realign2transcript.bam
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sample3_realign2transcript.bam...
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sample3_realign2transcript.bamdone
wrt_tr_to_csv for/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sample3_realign2transcript.bamdone
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sampleA_realign2transcript.bam...
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sampleA_realign2transcript.bamdone
wrt_tr_to_csv for/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sampleA_realign2transcript.bamdone
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sample2_realign2transcript.bam...
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sample2_realign2transcript.bamdone
wrt_tr_to_csv for/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sample2_realign2transcript.bamdone
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sample1_realign2transcript.bam...
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sample1_realign2transcript.bamdone
wrt_tr_to_csv for/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpczK7fZ/file9bd458837555/sample1_realign2transcript.bamdone
annotate_full_splice_match_all_sample...
[ FAIL 0 | WARN 195 | SKIP 0 | PASS 59 ]

[ FAIL 0 | WARN 195 | SKIP 0 | PASS 59 ]
	Counter({'counted_reads': 358})
	Counter({'counted_reads': 358})
	Counter({'counted_reads': 269})
	Counter({'counted_reads': 273})
> 
> proc.time()
   user  system elapsed 
319.273  19.446 343.384 
/Users/biocbuild/.pyenv/versions/3.11.9/lib/python3.11/multiprocessing/resource_tracker.py:254: UserWarning: resource_tracker: There appear to be 1 leaked semaphore objects to clean up at shutdown
  warnings.warn('resource_tracker: There appear to be %d '

Example timings

FLAMES.Rcheck/FLAMES-Ex.timings

nameusersystemelapsed
BulkPipeline2.2220.3503.424
MultiSampleSCPipeline4.3520.6225.380
SingleCellPipeline1.3980.1260.854
add_gene_counts0.0840.0030.088
annotation_to_fasta0.0560.0020.058
blaze2.1950.3492.976
bulk_long_pipeline1.4170.2981.242
combine_sce0.2230.0390.265
config-set0.1290.0180.151
config0.1450.0260.182
controllers-set0.1680.0450.223
controllers0.1490.0170.171
convolution_filter0.0010.0000.000
create_config0.0040.0010.005
create_sce_from_dir2.2870.6092.258
create_se_from_dir2.2740.2192.527
cutadapt0.0580.0220.085
example_pipeline0.1140.0170.135
experiment2.1360.1172.274
filter_annotation0.0150.0020.017
filter_coverage0.7610.0520.827
find_barcode0.6880.1240.837
find_bin0.0030.0050.009
find_diversity0.6340.2280.849
find_variants6.6310.3916.568
get_coverage0.8180.1641.009
index_genome0.1250.0190.149
mutation_positions0.6380.0050.654
plot_coverage1.4050.0701.496
plot_demultiplex1.2170.1601.558
plot_demultiplex_raw0.5470.0430.780
plot_durations2.2380.1442.422
plot_isoform_heatmap2.5570.1522.729
plot_isoform_reduced_dim 9.938 0.06810.044
plot_isoforms1.1630.0081.182
resume_FLAMES2.2150.1272.371
run_FLAMES2.2140.1712.422
run_step0.9460.0581.024
sc_DTU_analysis3.6210.6873.565
sc_genotype1.3080.0821.090
sc_impute_transcript0.1930.0050.199
sc_long_multisample_pipeline5.8331.2065.136
sc_long_pipeline2.0590.4551.758
sc_mutations1.4450.2681.344
sc_plot_genotype5.1860.1474.711
show-FLAMESPipeline0.1090.0160.130
steps-set0.1610.0200.187
steps0.0580.0140.075
weight_transcripts0.0100.0080.020